Article
Reference
The nucleotide sequence of replication and maintenance functions
encoded by plasmid pSCl0l
CHURCHWARD, Gordon, LINDER, Patrick, CARO, Lucien
Abstract
The nucleotide sequence of 1100bp around the origin of replication of the pSC101 plasmid
has been determined. This segment of DNA is capable of replication in the presence of a
helper plasmid. The sequence data reveal similarities between pSC101 and several other
replicons. The origin of replication contains three direct repeats of an 18bp sequence
associated with a segment exceptionally rich in A-T base pairs. A promotor that probably
directs transcription of a gene encoding an essential plasmid replication function is associated
with a region of extensive potential secondary structure. The sequence presented here
includes the sequence of the par region involved in partitioning of plasmids at cell division.
CHURCHWARD, Gordon, LINDER, Patrick, CARO, Lucien. The nucleotide sequence of
replication and maintenance functions encoded by plasmid pSCl0l. Nucleic Acids Research,
1983, vol. 11, no. 16, p. 5645-5659
DOI : 10.1093/nar/11.16.5645
Available at:
http://archive-ouverte.unige.ch/unige:149823
Disclaimer: layout of this document may differ from the published version.
1 / 1
Volume 11 Number 16 1983 Nucleic Acids Research
The nudeotMe sequence of repficatlon and maintenance functions encoded by ptasmki pSClOl
G.Churchward, P.Linder and L.Caro
Department of Molecular Biology, University of Geneva, Geneva, Switzerland
Received 4 July 1983; Accepted 27 July 1983
ABSTRACT
The nucleotide sequence of llOObp around the origin of
replication of the pSClOl plasmid has been determined. This
segment of DNA is capable of replication in the presence of a
helper plasmid. The sequence data reveal similarities between
pSClOl and several other replicons. The origin of replication
contains three direct repeats of an 18bp sequence associated
with a segment exceptionally rich in A-T base pairs. A
promotor that probably directs transcription of a gene
encoding an essential plasmid replication function is
associated with a region of extensive potential secondary
structure. The sequence presented here includes the sequence
of the par region involved in partitioning of plasmids at
cell division.
INTRODUCTION
We have recently described (1) the isolation and genetic
analysis of a series of insertions of the transposon TnlOOO
(gamma-delta; 2) into the replication region of the plasmid
pSClOl
(3,4).
These insertions were into a hybrid plasmid,
pLC709,
consisting of the HincIIA fragment of pSClOl ligated
to a mini-colEl plasmid and an antibiotic resistance marker
(1).
The HincIIA fragment has been shown to encode all the
functions required for pSClOl replication (5). The leftward
limit of the essential region (as drawn in figure 1 and 3) is
the Haell site (5; figure 1) and the rightward limit is
before the Rsal site (1; figure 1). The plasmid replication
genes identified by the analysis of the insertion mutations
are shown in figure 3.
We were able to define a 200 bp locus responsible for
the expression of pSClOl-specific incompatibility (1). This
locus lies within a larger region of approximately 450 bp
© IRL Press Limited, Oxford, England. 5645
Downloaded from https://academic.oup.com/nar/article/11/16/5645/2379268 by University de Geneve user on 24 February 2021
Nucleic Acids
Research
constituting an origin of replication that can function in
the presence of a helper plasmid. This helper plasmid
provides a function, rep, required for pSClOl replication and
encoded by a segment of DNA adjacent to the origin of
replication (1). Another function, par, responsible for the
accurate partitioning of plasmids to daughter cells at
division has been described and mapped to the other side of
the replication origin from the rep locus (5). Examination of
replicating molecules by electron microscopy shows that
replication is unidirectional and proceeds towards the par
locus (6; P. Linder, unpublished
results).
We have used the insertions of TnlOOO to determine the
nucleotide sequence of the origin region and adjacent DNA
segments of pSClOl. Chemical sequencing (7) from restriction
sites located near to the ends of the transposon TnlOOO has
generated a series of overlapping sequences that can be
assembled to yield the sequence of the pSClOl replication
origin and, simultaneously, locate each insertion within that
region.
From the properties of the insertion mutants we have
assigned functions to certain features of the DNA sequence.
The pSClOl plasmid requires the product of the dnaA gene
of E.coli for its replication
(8,9).
Since the product of
this gene is essential for replication of the E.coli
chromosome both _in vivo (10) and _in vitro
(11)
,
we have
compared the sequence of the pSClOl replication origin with
that of oriC
(12)
.
This comparison has revealed limited but
possibly significant sequence homology between the two
origins of replication. We have also compared the pSClOl
sequence with that of other replication origins and the
results of this comparison are discussed.
MATERIALS AND METHODS
Bacterial strains, plasmids and cloning procedures
All standard techniques have been described previously
(1).
The isolation and properties of the TnlOOO insertion
mutants have been described (1). The insertions were isolated
by conjugal mobilization of the pLC709 plasmid by the sex
factor F
(1,2).
The vector plasmid
pHP37,
used for cloning
5646
Downloaded from https://academic.oup.com/nar/article/11/16/5645/2379268 by University de Geneve user on 24 February 2021
Nucleic Acids Research
DNA fragments prior to sequencing, is similar to pHP34 (13)
and is pBR322 (14) with an insertion of 14 base pairs at the
EcoRI site, resulting in the sequence GAATTAATTCCCGGGAATTC,
which contains a site for Smal cleavage adjacent to an EcoRI
site.
Both these cleavage sites are unique in the plasmid and
DNA fragments can thus be cloned into the Smal site and
sequenced by labelling the ends generated by EcoRI cleavage
in a fashion analogous to that described for pHP34 (13).
To construct
pHP37,
the plasmid pKP6 (13), employed in
the construction of pHP34
(13) ,
was used. This plasmid is
pBR322 carrying a DNA fragment specifying resistance to the
antibiotics streptomycin and spectinomycin, flanked by sites
for Smal and
EcoRI.
The EcoRI site adjacent to the ampicillin
resistance gene of pKP6 was destroyed after protection, with
RNA polymerase (15), of the EcoRI site adjacent to the
tetracycline resistance gene. Following digestion with EcoRI
the cohesive ends were filled in, using the Klenow fragment
of DNA polymerase I, then the DNA was recircularized with T4
DNA ligase and used to transform E.coli. A plasmid was
recovered that retained only a single EcoRI site adjacent to
the tetracycline resistance gene of
pKP6.
DNA of this plasmid
was digested with Smal and recircularized to remove the
streptomycin resistance fragment of
pKP6,
resulting in
pHP37.
DNA sequencing
All sequences were determined by the chemical
degradation procedures of Maxam and Gilbert (7), with
modifications described by Smith and Calvo (16) and Will et
al.
(17). DNA fragments were end-labelled with P by use of
either T. polynucleotide kinase or the Klenow fragment of E.
coli DNA polymerase I.
Two general sequencing strategies were used (figure 1).
The restriction endonuclease Rsal cleaves 30bp from each end
of TnlOOO (18). Each insertion plasmid was cleaved with Rsal
and the two junction fragments, consisting of pSClOl
sequences joined to 30bp of TnlOOO DNA, were purified by gel
electrophoresis. After end-labelling with T4 polynucleotide
kinase and secondary restriction enzyme cleavage, the
resulting fragments, now labelled at one end, were sequenced.
5647
Downloaded from https://academic.oup.com/nar/article/11/16/5645/2379268 by University de Geneve user on 24 February 2021
Nucleic Acids Research
H/ncI
Woel
1
Aval
1
22 36
\\
3£
t
\i
Rsal
I
-WOO
Figure 1.
Sequencing strategy. The restriction map and the sites of
TnlOOO insertions (1) into the origin region of pSClOl are
presented. Below are the sequences determined either from
purified fragments
(<N/N/V/\)
or from fragments cloned in pHP37
(
) .
The DNA was labelled either with T4 polynucleotide
kinase (•) or DNA polymerase I Klenow fragment (X).
The junction fragments were also cloned into the Smal site of
pHP37,
in both orientations. The resulting plasmids were then
digested with
EcoRI,
end-labelled and digested with
Clal.
This resulted in a large fragment corresponding to pSClOl DNA
and most of pBR322, and a 26bp EcoRI-Clal pBR322 fragment.
This mixture of fragments was sequenced without further
purification if the first 26bp of the large fragment was
TnlOOO DNA. Otherwise, the DNA was digested with a suitable
restriction enzyme to cleave the large fragment and the
appropriate labelled fragment was purified by gel
electrophoresis.
RESULTS
Characteristics of the sequence
The nucleotide sequence of llOObp around the origin of
replication of pSClOl is presented in figure 2 and an
interpretative drawing showing certain features is presented
in figure 3.
A striking feature of the sequence around the
replication origin is an 80bp stretch rich in A-T base pairs
(84 %) beginning at coordinate 503, followed by 3 direct
repeats of an 18bp sequence at coordinates 582, 603, and 635.
The repeated sequences at coordinates 582 and 635 have an
additional 6 base-pairs that are homologous. This segment of
DNA between the sites of the TnlOOO insertions 14 and 36
5648
Downloaded from https://academic.oup.com/nar/article/11/16/5645/2379268 by University de Geneve user on 24 February 2021