Showing papers in "European Biophysics Journal in 1993"

Fluorescence correlation spectroscopy with high count rate and low background: analysis of translational diffusion

Abstract: An epi-illuminated microscope configuration for use in fluorescence correlation spectroscopy in bulk solutions has been analyzed. For determining the effective sample dimensions the spatial distribution of the molecule detection efficiency has been computed and conditions for achieving quasi-cylindrical sample shape have been derived. Model experiments on translational diffusion of rhodamine 6G have been carried out using strong focusing of the laser beam, small pinhole size and an avalanche photodiode in single photon counting mode as the detector. A considerable decrease in background light intensity and measurement time has been observed. The background light is 40 times weaker than the fluorescence signal from one molecule of Rh6G, and the correlation function with signal-to-noise ratio of 150 can be collected in 1 second. The effect of the shape of the sample volume on the autocorrelation function has been discussed.

Alamethicin and related peptaibols : model ion channels

Abstract: Peptaibols are considered as models of those ion channels which consist of a bundle of transbilayer helices surrounding a central pore. X-Ray diffraction and NMR studies have yielded high resolution structures for several peptaibols. In conjunction with other spectroscopic investigations and molecular dynamics simulations, these studies suggest that peptaibols form proline-kinked α-helices, and that there may be “hinge-bending” movement of the helix in the region of the central proline residue. The amphipathicity of peptaibol helices is analyzed in relation to their channel-forming properties. Studies of the interactions of peptaibols with lipid bilayers suggest that they are helical when in a membrane-like environment, and that the helix orientation relative to the bilayer is sensitive to the peptaibol: lipid ratio, and to the degree of hydration of the bilayer. Electrical studies reveal that many peptaibols form multiple-conductance level channels in a voltage-dependent fashion. Analysis of conductance levels provides support for the “barrel stave” model of channel formation, whereby different conductance levels correspond to different numbers of monomers in a helix bundle. Alternative models for voltage-activation are discussed, and the roles of molecular dipoles and of hinge-bending in this process are considered. Two molecular models for an N = 6 bundle of alamethicin helices are presented and their electrostatic properties analyzed. The relevance of studies of peptaibols to channel and transport proteins in general is considered.

Total internal reflection fluorescence microscopy: application to substrate-supported planar membranes

Abstract: The use of total internal reflection illumination in fluorescence microscopy (TIRFM) is reviewed with emphasis on application to fluorescent macromolecules that specifically and reversibly bind to planar model membranes supported on glass or quartz substrates. Several methods for characterizing macromolecular motion and organization are discussed: the measurement of equilibrium binding curves to obtain values for equilibrium binding constants; the measurement of fluorescence photobleaching recovery curves to obtain values of kinetic rate constants and surface diffusion coefficients; and the measurement of fluorescence intensities as a function of the evanescent field polarization to characterize orientational order. Applications to cell-substrate contact regions are summarized and future directions of TIRFM are outlined.

RNA multi-structure landscapes: a study based on temperature dependent partition functions.

Abstract: Statistical properties of RNA folding landscapes obtained by the partition function algorithm (McCaskill 1990) are investigated in detail. The pair correlation of free energies as a function of the Hamming distance is used as a measure for the ruggedness of the landscape. The calculation of the partition function contains information about the entire ensemble of secondary structures as a function of temperature and opens the door to all quantities of thermodynamic interest, in contrast with the conventional minimal free energy approach. A metric distance of structure ensembles is introduced and pair correlations at the level of the structures themselves are computed. Just as with landscapes based on most stable secondary structure prediction, the landscapes defined on the full biophysical GCAU alphabet are much smoother than the landscapes restricted to pure GC sequences and the correlation lengths are almost constant fractions of the chain lengths. Correlation functions for multi-structure landscapes exhibit an increased correlation length, especially near the melting temperature. However, the main effect on evolution is rather an effective increase in sampling for finite populations where each sequence explores multiple structures.

The double ππ5.6 helix of gramicidin A predominates in unsaturated lipid membranes

Abstract: The structure of the channel-forming polypeptide gramicidin A (GA) incorporated into phosphatidylcholine (PC) liposomes has been studied as a function of the degree of unsaturation of the acyl chains of PC. The initial conformational state of GA in reconstituted bilayers is determined by the solvent in which the peptide and the lipid are initially co-dissolved, whereas the equilibrium conformational state (after heat incubation) is affected by the lipid structure rather than by the nature of the solvent. The conformational equilibrium of GA has been studied in liposomes prepared from PC having a variable number of double bonds in the fatty acid moiety, by circular dichroism and Fourier transform infrared. Liposomes were prepared from trifluoroethanol or ethanol solutions and incubated at 68°C. GA was shown to retain the conformation of the right-handed π $$\overleftarrow 6$$ .3 π $$\overrightarrow 6$$ .3 helix in PC with saturated acyl chains and with one double bond, whereas in dilinoleoyl-PC, having two double bond in each chain, the thermodynamically preferred structures are left-handed antiparallel and parallel double ππ5.6 helices. Natural soybean PC also favours left-handed ππ5.6 helical structures of GA (≈75%). This finding is discussed in terms of the role of PC unsaturation in the dynamic properties of the lipid matrix. Differences between observed FTIR spectra of the ↑↓ππ=5.6 helix in solution (and to a larger extent in the membrane) and the calculated IR spectra can be interpreted as resulting from deviation of the real structure from the theoretically derived ideal helix. The data obtained provide grounds for better understanding of a GA channel functioning in lipids of variable degrees of unsaturation.

The viscoelasticity of entangled actin networks: the influence of defects and modulation by talin and vinculin

Abstract: Rheological measurements of the frequency-dependent complex elastic module G*(ω) of entangled F-actin solutions in the frequency range 10−5 − 1 Hz were carried out in three dynamic regimes: 1.) A terminal relaxation from gel-like to liquid-like behaviour measured at frequencies ω < τd −1 2.) a rubber-type plateau and 3.) a regime determined by chain conformational transitions at frequencies ω > τi −1. A major point of interest was to clarify whether rheological, high precision measurements can yield quantitative information about the influence of talin and vinculin on the structure, chain dynamics, elasticity and viscoelasticity of actin filaments with time. We show that in the regime reflecting internal chain dynamics (10−2 to 1 s time domain), F-actin behaves as a random coil of the Rouse type. This contrasts with dynamic light scattering and correlation spectroscopic studies of actin filament flickering, which indicate that filaments behave as semiflexible rods. The internal chain dynamics, which are determined by thermically excited bending undulations, exhibit a persistence length of 0.3−1 μm Evidence is provided that this discrepancy is due to a cross-over of semiflexible rod behaviour at excitation wavelengths (Λ) below approximately 1 gm to random-coil behaviour at Λ 1 µ (expected at a frequency ω ∼ 1 Hz). The random coil behaviour is largely determined by defects in actin filaments leading to sharp bends of the chain which act as semiflexible hinges. Talin produces drastic effects on the time course of viscoelasticity during actin polymerization. It promotes the rapid formation of short filament fragments (∼ 1 gmm, within time scales of min) which anneal slowly into long filaments (within several hours), most probably by fusion. The viscoelasticity depends on the coexistence of short and very long filaments indicated by the elongation of the rubber plateau. The most dramatic effect is a reduction of the ratio of the terminal ('Ed) to the Rouse relaxation time of τi by more than one order of magnitude (τd/τi = 100 compared to ratio τd/i = 2000 for pure actin). From this it is concluded that talin causes a remarkable decrease in the effective segment length of the macromolecule and, thus induces an increase in chain stiffness. Vinculin on the other hand shows no such effect.

Induction of changes in the secondary structure of globular proteins by a hydrophobic surface.

Abstract: Circular dichroism, ellipsometry and radiolabeling techniques were employed to study the induction of changes in the secondary structure of BSA, myoglobin and cytochrome C by a hydrophobic surface. The results showed that adsorbed protein molecules lose their ordered native structure in the initial stage of adsorption and the structure appears to be a random or disordered conformation. Protein molecules adsorbed in later stages adopt a more ordered secondary structure (alpha helix and beta structure). The changes of secondary structure of globular proteins induced by a hydrophobic surface can be explained by the steric interaction between adsorbed proteins as well as by hydrophobic interactions during the adsorption process. In addition, there is obviously an intermediate stage in which the protein molecules are mainly in the beta structure, indicating that for certain proteins, the beta structure may be a more stable secondary structure than alpha helix on the hydrophobic surface.

Lipid enrichment and selectivity of integral membrane proteins in two-component lipid bilayers

Abstract: A model recently used to study lipid-protein interactions in one-component lipid bilayers (Sperotto and Mouritsen, 1991 a, b) has been extended in order to include two different lipid species characterized by different acyl-chain lengths. The model, which is a statistical mechanical lattice model, assumes that hydrophobic matching between lipid-bilayer hydrophobic thickness and hydrophobic length of the integral protein is an important aspect of the interactions. By means of Monte Carlo simulation techniques, the lateral distribution of the two lipid species near the hydrophobic protein-lipid interface in the fluid phase of the bilayer has been derived. The results indicate that there is a very structured and heterogeneous distribution of the two lipid species near the protein and that the protein-lipid interface is enriched in one of the lipid species. Out of equilibrium, the concentration profiles of the two lipid species away from the protein interface are found to develop a long-range oscillatory behavior. Such dynamic membrane heterogeneity may be of relevance for determining the physical factors involved in lipid specificity of protein function.

Flexoelectric effects in model and native membranes containing ion channels.

Abstract: An experimental study of flexoelectricity in model membranes containing ion pores and native membranes containing ion channels has been undertaken with the objective of determining the relationship, if any, between flexoelectricity and ion transport. Model membrane patches containing ion pores induced by a bluegreen algal toxin, microcystin-LR, and locust muscle membrane patches containing potassium channels were studied using patch-clamp techniques. A correspondence was established between the presence of open channels and pores and the amplitude of the 1st harmonic of the total membrane current when the membranes or patches were subjected to pressure oscillations. The 2nd harmonic of the membrane current provided a measure of the amplitude of a membrane curvature induced by pressure, thus making it possible to determine the membrane flexoelectric coefficient. This study shows that flexoelectricity could be an effective driving force for ion transport through membrane pores and channels, thus further highlighting the possible biological significance of this mechano-electric phenomenon.

Modulation and block of the plasma membrane anion channel of guard cells by stilbene derivatives

Abstract: An anion channel in the plasma membrane of guard cells (GCAC1) provides a regulatory element for the voltage-dependent release of anions during stomatal closure (Keller et al. 1989) as well as excitability (Hedrich et al. 1990). Recognition sites for plant growth hormones on the extracellular surface of GCAC1 further indicate that this channel may also serve as a transduction element in hormone signaling (Marten et al. 1991 a). Stilbene derivatives were used to study the inhibitor-structure channel-function relationship of GCAC1. We have analyzed the activity, voltage-gate and kinetics of this channel as affected by stilbenes. The stilbene derivatives SITS and DNDS caused a shift in activation potential and a decrease in the peak current amplitude. Channel block through the action of DIDS, on the other hand, was not accompanied by a shift in voltage-dependence. Differences in the dose-dependence of the two effects give clues to the presence of channel sites responsible for gate-shifting and block. The ability to inhibit anion currents (Kd) increased in the sequence: SITS (4 µM) < DNDS (0.5 µM) < DIDS (0.2 µM). All inhibitors reversibly blocked the anion channel from the extracellular side. Channel block on the level of single anion-channels is characterized by a reduction of long open-transitions into flickering bursts and a decrease in channel amplitude.

Magic angle spinning 13C-NMR spin-lattice relaxation study of the location and effects of α-tocopherol, ubiquinone-10 and ubiquinol-10 in unsonicated model membranes

Abstract: α-Tocopherol, ubiquinone-10 and ubiquinol-10 have been studied by high resolution magic angle samples spinning 13C-nuclear magnetic resonance in egg yolk phosphatidylcholine multilamellar vesicles model membranes in order to assess their location and the induced perturbations on this model system. α-Tocopherol is placed in such a position that it is in close contact with the head group of the phospholipid and exposed to the solvent. In this position it significantly perturbs the phospholipid head group, the 5a-CH3 and the 7a-CH3 groups being the closest parts to the membrane surface. On the other hand, ubiquinol-10 perturbs the membrane surface more than ubiquinone-10, but neither compound significantly changed the phospholipid head group conformation.

Voltage-dependent inhibition of the sodium pump by external sodium: Species differences and possible role of the N-terminus of the α-subunit

Abstract: Currents generated by the Na+/K+ ATPase were measured under voltage clamp in oocytes of Xenopus laevis. The dependence of pump current on external [Na+] was investigated for the endogenous Xenopus pump as well as for wild-type and mutated pumps of electroplax of Torpedo californica expressed in the oocytes. The mutants had α-subunits truncated before position Lys28 (αΔK28) or Thr29 (αΔT29) of the N-terminus. The currents generated by all variants of pump molecules in the presence of 5 mM K+ show voltage-dependent inhibition by external [Na+]. The apparent K1 values increase with membrane depolarisation, and the potential dependence can be described by the movement of effective charges in the electrical potential gradient across the membrane. Taking into account Na+-K+ competition for external binding to the E2P form, apparent K1 values and effective charges for the interaction of the Na+ ions with the E2P form can be estimated. For the Xenopus pump the effective charge amounts to 1.1 of an elementary charge and the K1 value at 0 mV to 44 mM. For the wild-type Torpedo pump, the analysis yields values of 0.73 of an elementary charge and 133 mM, respectively. Truncation at the N-terminus removing a lysinerich cluster of the a-subunit of the Torpedo pump leads to an increase of the effective charge and decrease of the K1 value. For αΔK28, values of 0.83 of an elementary charge and 117 mM are obtained, respectively. If LyS28 is included in the truncation (α·T29), the effective charge increases to 1.5 of an elementary charge and the apparent K1 value is reduced to 107 mM. The K, values for pump inhibition by external Na+, calculated by taking into account Na+-K+ competition, are smaller than the K/12 values determined in the presence of 5 mM [K+]. The difference is more pronounced for those pump variants that have higher Km, values. The variations of the parameters describing inhibition by external [Na+] are qualitatively similar to those described for the stimulation of the pumps by external [K+] in the absence of extracellular [Na+]. The observations may be explained by an acess channel within the membrane dielectric that has to be passed by the external Na+ and K+ ions to reach or leave their binding sites. The potential-dependent access and/or the interaction with the binding sites shows species differences and is affected by cytoplasmic lysine residues in the N-terminus.

The influence of the effectors of yeast pyruvate decarboxylase (PDC) on the conformation of the dimers and tetramers and their pH-dependent equilibrium.

Abstract: The influence of effectors of yeast pyruvate decarboxylase, phosphate, pyruvamide, thiamin diphosphate and Mg++, on the pH-dependent equilibrium between dimers and tetramers was studied by synchrotron radiation X-ray solution scattering. Thiamin diphosphate and phosphate shift the equilibrium to higher pH values without altering the structure of the oligomers. Pyruvamide, a substrate analogue activator, induces a significant change in the structure of the tetramer. By eliminating radiation damage by addition of dithioerythrol to the buffers, the scattering curves could be measured accurately over a large angular range. They were expanded in terms of spherical harmonics to obtain the shapes of the dimers and tetramers with higher resolution than was hitherto possible. This also allowed us to position the dimers, which are centrosymmetric at low resolution, in the tetramers which have 222 symmetry. The results indicate that addition of pyruvamide results in a less compact tetramer owing to structural changes in the dimers and to their displacements.

Kinetic study into the irreversible thermal denaturation of bacteriorhodopsin

Abstract: We report on a differential scanning calorimetry study of native purple membranes under the following solvent conditions: 50 mM carbonate-bicarbonate, 100 mM NaCl, pH 9.5 and 190 mM phosphate, pH 7.5. The calorimetric transitions for bacteriorhodopsin denaturation are highly scanning-rate dependent, which indicates that the thermal denaturation is under kinetic control. This result is confirmed by a spectrophotometric study on the kinetics of the thermal denaturation of this protein. The calorimetric data at pH 9.5 conform to the two-state irreversible model. Comments are made regarding the information obtainable from differential scanning calorimetry studies on bacteriorhodopsin denaturation and the effect of irreversibility on the stability of membrane proteins.

Special features of phosphatidylcholine vesicles as seen in cryo-transmission electron microscopy

Abstract: Vesicles of egg yolk phosphatidylcholine (EYPC) were studied by cryo-transmission electron microscopy. The electron micrographs indicate that, despite the rapidity of cooling, membrane undulations are flattened and some vesicles change their shapes before the samples freeze. These artefacts are attributed to the action of the lateral tension that results from the membrane area contraction associated with the temperature drop. Other micrographs represent grainy membranes and angular vesicles. We regard them as the first direct evidence for the superstructure and optically invisible roughness which were recently postulated for these membranes.

Predicting secondary structures of membrane proteins with neural networks

Abstract: Back-propagation, feed-forward neural networks are used to predict the secondary structures of membrane proteins whose structures are known to atomic resolution. These networks are trained on globular proteins and can predict globular protein structures having no homology to those of the training set with correlation coefficients (C) of 0.45, 0.32 and 0.43 for αa-helix, β-strand and random coil structures, respectively. When tested on membrane proteins, neural networks trained on globular proteins do, on average, correctly predict (Qi) 62%, 38% and 69% of the residues in the α-helix, β-strand and random coil structures. These scores rank higher than those obtained with the currently used statistical methods and are comparable to those obtained with the joint approaches tested so far on membrane proteins. The lower success score for β-strand as compared to the other structures suggests that the sample of β-strand patterns contained in the training set is less representative than those of a-helix and random coil. Our analysis, which includes the effects of the network parameters and of the structural composition of the training set on the prediction, shows that regular patterns of secondary structures can be successfully extrapolated from globular to membrane proteins.

Fourier transform infrared spectroscopic study of ion binding and intramolecular interactions in the polar head of digalactosyldiacylglycerol

Abstract: Lipid bilayers composed of digalactosyldiacyl-glycerol (DGDG), that is, Galpα1-6Galpβ1-3DAG, a non-ionic lipid of the thylakoid membrane of chloroplasts, aggregate in aqueous media containing mono- and divalent cations in amounts above a threshold concentration (Ct) of about 1.0, 4.7 and 10.0 mM for Ca2+, Mg2+ and Na+, respectively. In this work, we found that above Ct the DGDG membranes do not undergo fusion and that the aggregation can be reversed, or disrupted. This means that the perturbation induced by the salts results from adsorption, or complexation of the ions in the polar head of DGDG. To investigate this question, we used Fourier transform infrared (FTIR) spectroscopy to identify the molecular sites in DGDG which are modified by interaction, or adduct formation with CaCl2, MgCl2 and NaCl. We also determined whether the ions affect the intramolecular hydrogen bonding between the sn2 ester C = O and the carbon-6 of the α-anomer of galactose (Gal). The major conclusions are: (i) the salts do not affect, at least directly, the, ester carbonyl region of DGDG, (ii) the most probable sites of binding, or adsorption, for the ions are the ring oxygen, and (iii) the ring hydroxyls are the sites of either ion complexation or intra- and intermolecular H-bonding in interacting DGDG membranes. Within this framework, the complexation of the ions with Gal might induce total or partial dehydration of the galactolipid headgroup and thus provides the means to overcome the repulsive hydration forces that hinder aggregation of the DGDG membranes.

A site accessible to extracellular TEA+ and K+ influences intracellular Mg2+ block of cloned potassium channels.

Abstract: The members of the RCK family of cloned voltage-dependent K+ channels are quite homologous in primary structure, but they are highly diverse in functional properties. RCK4 channels differ from RCK1 and RCK2 channels in inactivation and permeation properties, the sensitivity to external TEA, and to current modulation by external K+ ions. Here we show several other interesting differences: While RCK1 and RCK2 are blocked in a voltage and concentration dependent manner by internal Mg2+ ions, RCK4 is only weakly blocked at very high potentials. The single-channel current-voltage relations of RCK4 are rather linear while RCK2 exhibits an inwardly rectifying single-channel current in symmetrical K+ solutions. The deactivation of the channels, measured by tail current protocols, is faster in RCK4 by a factor of two compared with RCK2. In a search for the structural motif responsible for these differences, point mutants creating homology between RCK2 and RCK4 in the pore region were tested. The single-point mutant K533Y in the background of RCK4 conferred the properties of Mg2+ block, tail current kinetics, and inward ion permeation of RCK2 to RCK4. This mutant was previously shown to be responsible for the alterations in external TEA sensitivity and channel regulation by external K+ ions. Thus, this residue is expected to be located at the external side of the pore entrance. The data are consistent with the idea that the mutation alters the channel occupancy by K+ and thereby indirectly affects internal Mg2+ block and channel closing.

Ion channel formation by zervamicin-IIB. A molecular modelling study.

Abstract: Zervamicin-IIB (Zrv-IIB) is a 16 residue peptaibol which forms voltage-activated, multiple conductance level channels in planar lipid bilayers. A molecular model of Zrv-IIB channels is presented. The structure of monomeric Zrv-IIB is based upon the crystal structure of Zervamicin-Leu. The helical backbone is kinked by a hydroxyproline residue at position 10. Zrv-IIB channels are modelled as helix bundles of from 4 to 8 parallel helices surrounding a central pore. The monomers are packed with their C-terminal helical segments in close contact, and the bundles are stabilized by hydrogen bonds between glutamine 11 and hydroxyproline 10 of adjacent helices. Interaction energy profiles for movement of three different probes species (K+, Cl- and water) through the central pore are analyzed. The conformations of: (a) the sidechain of glutamine 3; (b) the hydroxyl group of hydroxyproline 10; and (c) the C-terminal hydroxyl group are "optimized" in order to maximize favourable interactions between the channel and the probes, resulting in favourable interaction energy profiles for all three. This suggests that conformational flexibility of polar sidechains enables the channel lining to mimic an aqueous environment.

Solvent modulation of the structural heterogeneity in FeIII myoglobin samples : a low temperature EPR investigation

Abstract: High spin FeIII myoglobin samples in solutions with different solvent composition have been investigated at low temperature by Electron Paramagnetic Resonance spectroscopy. The g = 6 line of the spectrum has been analyzed in terms of a distribution of the two crystal field parameters Δ1 and Δ2. By means of the Angular Overlap Method, it has been shown that these distributions entail, in turn, a distribution in the iron-heme displacement along the normal to the heme-plane. The spread in this iron-heme distance, which can be connected with the binding action of the proximal histidine, has been proposed as a quantitative measurement of the structural heterogeneity (conformational substate landscape) displayed by the protein molecules. The results point out, moreover, that the solvent composition can affect the structural heterogeneity of the protein system. In particular, addition of glycerol, ethylene glycol and sucrose yields a significant reduction in the spread of the ironheme displacement, while the presence of ammonium sulfate induces a change in the average position of the iron in the heme-plane. The role played by the solvent in the structure and dynamics of the protein, in connection also with the conformational substate distribution, is discussed.

Protein dynamics: conformational disorder, vibrational coupling and anharmonicity in deoxy-hemoglobin and myoglobin.

Abstract: In this work we study the temperature dependence of the Soret band lineshape of deoxymyoglobin and deoxyhemoglobin, in the range 300−20 K. To fit the measured spectra we use an approach originally proposed by Champion and coworkers (Srajer et al. 1986; Srajer and Champion 1991). The band profile is modelled as a Voigt function that accounts for the coupling with low frequency vibrational modes, whereas the coupling with high frequency modes is responsible for the vibronic structure of the spectra. Moreover, owing to the position of the iron atom out of the mean heme plane, inhomogeneous broadening brings about a non-Gaussian distribution of 0–0 electronic transition frequencies. The reported analysis enables us to isolate the various contributions to the overall bandwidth, and their temperature dependence points out the relevance of low frequency vibrations and of large scale anharmonic motions starting at temperatures higher than 170 K. Information on the mean iron-heme plane distance and on its temperature dependence, as well as on the heme pocket conformational disorder, is also obtained.

The molecular force field of guanine and its deuterated species as determined from neutron inelastic scattering and resonance Raman measurements

Abstract: Neutron inelastic scattering (NIS) spectra from polycrystalline samples and ultraviolet resonance Raman scattering (RRS) spectra from aqueous solutions of guanine and CS-deuterated and (N9, NI, C2-amino)-deuterated guanine are reported. These measurements allowed theoretical simulations of the vibrational wavenumbers and intensities of the NIS and RRS bands to be performed. A valence force field enabled the normal mode wavenumbers, as well as the atomic displacements, to be calculated. The NIS intensities were simulated by considering multi-phonon interactions arising from the lattice mode couplings with the internal molecular vibrational modes. The RRS intensities were simulated within the framework of the so-called “small shift approximation”, by using the molecular bond-order changes induced by the electronic transition from the ground to the first electronic excited state. It is shown that NIS spectroscopy mainly provides information on the guanine out-of-plane modes of vibration, while RRS allows the in-plane stretching vibrational motions to be analyzed.

Interactions of native and modified cytochrome C with a negatively charged reverse micellar liquid interface

Abstract: Native and chemically modified cytochrome C were dissolved in sodium bis(2-ethylhexyl) sulphosuccinate (AOT)-oil-buffer microemulsions. The native cytochrome C contains 19 lysine residues, these groups were modified by 1) acetic anhydride or 2) succinic anhydride. At pH 8.4 the native, acetylated and succinylated proteins carry +8, −3 and −12 elementary charges, respectively. The phase behaviour of the microemulsion systems was found to be highly dependent on the charge of the proteins. Compared to a protein free system the native protein induces a L-2 phase separation at lower temperatures. The acetylated protein has a small effect on the temperature for the phase transition, whereas in the case of succinylated cytochrome C the phase transition takes place at higher temperatures. When dissolved in AOT microemulsions, the native cytochrome C has a perturbed tertiary structure, as indicated by loss of the 695 nm absorption band, while both the modified proteins retain the same optical properties when dissolved in an AOT microemulsion as in a pure buffer solution. The pertubed structure of the native cytochrome C was further investigated by testing the stability of the reduced form of the protein dissolved in the microemulsion media. The native cytochrome is unstable at W > 10, whereas the two modified proteins were found to be stable at all W-values investigated. The average location of the three proteins was determined by pulse radiolysis. The quenching rate constant of the hydrated electron depends upon the location of the probe in the reverse micelle; the succinylated protein is localised in the aqueous core of the reverse micelles, but both the native and the acetylated forms were found to be localised close to or at the AOT interface.

Mathematical modelling of lipid transbilayer movement in the human erythrocyte plasma membrane.

Abstract: A model is presented to simulate transverse lipid movement in the human erythrocyte membrane. The model is based on a system of differential equations describing the time-dependence of phospholipid redistribution and the steady state distribution between the inner and outer membrane monolayer. It takes into account several mechanisms of translocation: (i) ATP-dependent transport via the aminophospholipid translocase; (ii) protein-mediated facilitated and (iii) carrier independent transbilayer diffusion. A reasonable modelling of the known lipid asymmetry could only be achieved by introducing mechanism (iii). We have called this pathway the compensatory flux, which is proportional to the gradient of phospholipids between both membrane leaflets. Using realistic model parameters, the model allows the calculation of the transbilayer motion and distribution of endogenous phospholipids of the human erythrocyte membrane for several biologically relevant conditions. Moreover, the model can also be applied to experiments usually performed to assess phospholipid redistribution in biological membranes. Thus, it is possible to simulate transbilayer motion of exogenously added phospholipid analogues in erythrocyte membranes. Those experiments have been carried out here in parallel using spin labeled lipid analogues. The general application of this model to other membrane systems is outlined.

Protein dynamics studied by NMR

Abstract: The results of NMR studies using several nuclei indicate that proteins have considerable internal mobility. The most obvious is the mobility of side-chains. This mobility is general on the exterior surfaces but extends internally in a differential way. The functional value of surface mobility concerns both on and off rates of ligand binding (e.g. metal ions and parts of substrates) and protein/protein interactions. The mobility, which indicates that recognition is more in the hand-in-glove class than in the lock-in-key class, makes for a modified view of the specificity of protein interactions. Thus, fast on/off systems cannot be as selective as slower systems. Segmental mobility of proteins is considered in the context of protein secondary structure. The least mobile segments are the β-sheet and the tight β-turn. Mobility is always possible for, but not within, rod-like helices and in loose turns. Many examples are given and the importance of mobility in molecular machines is described. Finally, examples are given of virtually random-coil proteins, segments, and linker regions between domains and the functional value of such extremely dynamic regions of proteins is discussed.

The existence of non-axisymmetric bilayer vesicle shapes predicted by the bilayer couple model.

Abstract: The existence of non-axisymmetric shapes with minimal bending energy is proved by means of a mathematical model. A parametric model is used; the shapes considered have an elliptical top view whilst their front view contour is described using Cassini ovals. Taking into account the bilayer couple model, the minimization of the membrane bending energy is performed at a constant membrane area A, a constant enclosed volume V and a constant difference between the two membrane leaflet areas delta A. It is shown that for certain sets of A, V and delta A the non-axisymmetric shapes calculated with the use of the parametric model have lower energy than the corresponding axisymmetric shapes obtained by the exact solution of the general variational problem. As an exact solution of the general variational problem for non-axisymmetric shapes would yield even lower energy, this indicates the existence of non-axisymmetric shapes with minimal bending energy in a region of the V/delta A phase diagram.

A refined three-dimensional solution structure of a carboxy terminal fragment of apolipoprotein CII

Abstract: The three-dimensional structure of a synthetic fragment of human apolipoprotein CII (apo-CII) in 35%, 1,1,1,3,3,3-hexafluoro-2-propanol (HFP) has been determined on the basis of distance and intensity constraints derived from two-dimensional proton nuclear magnetic resonance measurements. The NOE crosspeak build-up rates were converted to distance constraints which were used in the distance geometry program DIANA. A set of one hundred structures were generated and of these ten structures were used in molecular dynamics simulations using the program XPLOR. This program enabled a direct minimization between the difference of the two-dimensional NOE intensities and those calculated from the full relaxation matrix. In this way spin diffusion is fully taken into account, which can be seen from the considerable improvement of the R-factor after the relaxation matrix refinement. These calculations show that this fragment, which corresponds to the carboxy terminal 30 amino acids of intact apo-CII and which retains its ability to activate lipoprotein lipase, is essentially flexible, but has three defined secondary structural elements. The most significant one is an α-helix between residues 67 and 74. The following three residues adopt a turn-like structure. Another turn of α-helix is seen between residues 56 and 59. The effect of the solvent system on the secondary structure was studied by circular dichroism spectroscopy. The results show that the mixed aqueous 35% HFP solvent induces secondary structure of a very similar nature to the one induced by sodium dodecyl sulphate.

Determination of conformational transition rates in the trp promoter by 1H NMR rotating-frame T1 and cross-relaxation rate measurements.

Abstract: Rotating-frame relaxation measurements have been used in conjunction with spin-spin relaxation rate constants to investigate a conformational transition previously observed in the -10 region of the trp promoter d(CGTACTAGTTAACTAGTACG)2 (Lefevre, Lane, Jardetzky 1987). The transition is localised to the sub-sequence TAAC, and is in fast exchange on the chemical shift time-scale. The rate constant for the exchange process has been determined from measurements of the rotating-frame relaxation rate constant as a function of the spin-lock field strength, and is approximately 5000 s−1 at 30 °C. Measurements have also been made as a function of temperature and in two different magnetic fields: the results are fully consistent with those expected for the exchange contribution in a two-site system. A similar transition has been observed in d(GTGATTGACAATTA).d(CACTAACTGTTAAT), which contains the −35 region of the trp promoter. This has been investigated in the same way, and has been found to undergo exchange at a faster rate under comparable conditions. In addition, the cross-relaxation rate constants for Ade C2H-Ade C2H pairs have been measured as a function of temperature, and these indicate that certain internuclear distances in YAAY subsequences increase with increasing temperature. These changes in distance are consistent with a flattening of propellor twist of the AT base-pairs. The occurrence of conformational transitions in YAAY subsequences depends on the flanking sequence.

Two components of the receptor current are developed from distinct elementary signals in Limulus ventral nerve photoreceptor

Abstract: Transient elementary currents, bumps, stimulated by short dim light flashes were measured in ventral nerve photoreceptors of Limulus. It is demonstrated that light activates two types of bumps, which form two distinct components of the receptor current at higher light intensities. The two bump types, which are both assumed to be activated by single absorbed photons, differ in current amplitude and kinetic parameters. The current amplitude of one bump type is smaller than 0.3 nA and that of the other type is in the usual current range of up to several nanoamperes. The average latency of small bumps measured from the short stimulus flash is shorter than that of the large bumps. The small bumps have slower activation kinetics than the large bumps. It is demonstrated that with increasing flash intensity the small bumps overlap first and form a macroscopic current, on top of which the large bumps are superimposed. Results indicate that a single absorbed photon selectively activates only one kind of the enzyme cascades evoking one bump type. We conclude that the active meta conformation of a rhodopsin molecule selectively binds a specific type of G-protein, which is involved in the stimulation of one of the transduction cascades. The two bump types, which are the elements of two macroscopic current components support the previous assumption that light activates different transduction mechanisms in Limulus photoreceptors.

Hydrophilic surface maps of channel-forming peptides: analysis of amphipathic helices.

Abstract: Ion channels may be formed by bundles of amphipathic α-helices aligned parallel to one another and spanning a lipid bilayer membrane, with the hydrophilic faces of the helices lining a central pore. In order to provide insight into the packing of such helices in bundles, a method has been developed to evalute hydrophilic surface maps of amphipathic α-helices and to display these surfaces in a readily interpretable form. The procedure is based upon empirical energy calculations of interactions of a water molecule with an amphipathic α-helix. The method has been applied to three channel-forming peptides: Staphylococcal δ-toxin; alamethicin; and a synthetic leucine- and serine-containing peptide. Particular emphasis is placed upon the effects of sidechain conformational flexibility on hydrophilic surface maps. A family of models of the δ-toxin; helix is generated by a simulated annealing procedure. The results of hydrophilic surface map analyses provide more exact definition of the centre of the hydrophilic face of amphipathic helices, and of the variation of the position of the centre in response to changes in sidechain conformation. This information is used to define families of preliminary models for a given ion channel, as is illustrated for δ-toxin.