RES E A R C H A R T I C L E Open Access
Salicylic acid-related cotton (Gossypium
arboreum) ribosomal protein GaRPL18
contributes to resistance to Verticillium
dahliae
Qian Gong
†
, Zhaoen Yang
†
, Xiaoqian Wang, Hamama Islam Butt, Eryong Chen, Shoupu He, Chaojun Zhang,
Xueyan Zhang and Fuguang Li
*
Abstract
Background: Verticillium dahliae is a phytopathogenic fungal pathogen that causes vascular wilt diseases
responsible for considerable decreases in cotton yields. The complex mechanism underlying cotton resistance to
Verticillium wilt remains uncharacterized. Identifying an endogenous resistance gene may be useful for controlling
this disease.
Results: We cloned the ribosomal protein L18 (GaRPL18) gene, which mediates resistance to Verticillium wilt, from a
wilt-resistant cotton species (Gossypium arboreum). We then characterized the function of this gene in cotton and
Arabidopsis thaliana plants. GaRPL18 encodes a 60S ribosomal protein subunit important for intracellular protein
biosynthesis. However, previous studies revealed that some ribosomal proteins are also inhibitory toward
oncogenesis and congenital diseases in humans and play a role in plant disease defense. Here, we observed that
V. dahliae infections induce GaRPL18 expression. Furthermore, we determined that the GaRPL18 expression pattern
is consistent with the disease resistance level of different cotton varieties. GaRPL18 expression is upregulated by
salicylic acid (SA) treatments, suggesting the involvement of GaRPL18 in the SA signal transduction pathway.
Virus-induced gene silencing technology was used to determine whether the GaRPL18 expression level influences
cotton disease resistance. Wilt-resistant cotton species in which GaRPL18 was silenced became more susceptible to
V. dahliae than the control plants because of a significant decrease in the abundance of immune-related molecules.
We also transformed A. thaliana ecotype Columbia (Col-0) plants with GaRPL18 according to the floral dip method.
The plants overexpressing GaRPL18 were more resistant to V. dahliae infectio ns than the wild-type Col-0 plants. The
enhanced resistance of transgenic A. thaliana plants to V. dahliae is likely mediated by the SA pathway.
Conclusion: Our findings provide new insights into the role of GaRPL18, indicating that it plays a crucial role in
resistance to cotton “cancer”, also known as Verticillium wilt, mainly regulated by an SA-related signaling pathway
mechanism.
Keywords: Cotton, Verticillium wilt, Resistance gene, Ribosomal protein, GaRPL18, Salicylic acid
* Correspondence: aylifug@163.com
†
Equal contributors
State Key Laboratory of Cotton Biology, Institute of Cotton Research, Chinese
Academy of Agricultural Sciences, Anyang 455000, China
© The Author(s). 2017 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0
International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and
reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to
the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver
(http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Gong et al. BMC Plant Biology (2017) 17:59
DOI 10.1186/s12870-017-1007-5
Background
Verticillium dahliae Kleb. is a destructive phytopatho-
genic fungus that causes wilt diseases on more than 400
plant species, including cotton (Gossypium arboreum)
[1, 2]. Verticillium dahliae infects cotton by penetrating
the roots. It then spreads across the root cortex and
invades the xylem vessels where it forms the conidia
responsible for the colonization of vascular tissues and
functional impairment. This results in se veral symptoms,
including wilting, discoloration, necrosis, and defoliation
[3–6]. Cotton fiber quality and annual yields decrease as
a result of Verticillium wilt induced by V. dahliae, and a
severe outbreak can lead to yield losses of more than 30%
[7, 8]. In China, more than 40% of the cotton-growing
area is threatened by Verticillium wilt, potentially causing
considerable decreases in cotton production and serious
economic losses each year. Furthermore, the fungus can
survive for long periods in the soil even without a host,
making Verticillium wilt difficult to control using practical
and effective chemical treatments [9, 10]. Numerous
methods are used to reduce the incidence of Verticillium
wilt, such as the application of tillage, soil solarization, soil
amendments, and biological controls. However, these are
not always efficient or effective [11, 12]. Soil fumigation,
which is by far the most effective treatment for inhibiting
the propagation of Verticillium species, is costly and can
have lethal effects on human health and the environment
[7, 13]. The identification and isolation of disease-
responsive candidate genes, along with the development
of disease-resistant transgenic cotton cultivars, are essen-
tial for managing Verticillium wilt [14–16].
The ribosomal protein (RP) has complex structures
that differ in prokaryotes and eukaryotes. The eukaryotic
ribosome is composed of two unequal subunits (60S and
40S), four ribosomal RNAs (rRNAs), and 82 different
RPs. The small ribosomal subunit is composed of a
single 18S rRNA and approximately 33 proteins, while
the large subunit comprises 28S/25S, 5.8S, and 5S
rRNAs, as well as approximately 49 proteins [17–19].
The ribosome is a highly conserved protein that is essen-
tial for cellular activities. Although its main function is
to synthesize proteins, recent in-depth studies have
revealed that it is also important for cell growth, div-
ision, and development, an d gene regulation [20–22].
Recently, a study has shown that overexpression of the
N-terminal 99 amino acids of ribosomal protein L3
confers resistance to pokeweed antiviral protein and the
Fusarium mycotoxin deoxynivalenol in tobacco [23].
Another study has shown that rib osomal protein L12
and ribosomal protein L19 are important in nonhost dis-
ease resistance in N. benthamiana and A. thaliana.In
addition, these genes also play a minor role in basal
resistance against virulent pathogens [24]. In particular,
a recent study examining ribosomal protein S14 (RPS14)
and cancer concluded that this protein can specifically
interact with murine double minute 2 (MDM2) to inhibit
the degradation of p53 by MDM2 ubiquitin, thereby pro-
moting p53 activity. In gastric and colorectal cancer cells
the cell cycle is arrested and tumor cell growth is inhibited
in the presence of abundant RPS14 [25]. Another study
revealed that ribosomal protein L4 can also regulate the
MDM2–p53 loop to regulate p53 activity [26]. Although
these studies suggest that RPs are important for disease
resistance, they did not include cotton species. Therefore,
a more thorough characterization of the function of the
cotton RP may be useful for the breeding of Verticillium
wilt-resistant cotton varieties.
Under natural conditions, plants frequently encounter
diverse potential pathogens. Plants are constantly evolv-
ing to cope with these biotic stresses. For example,
plants have evolved an immune system that inc ludes
constitutive and inducible defense systems that offer pro-
tection from potentially dangerous pathogens [27, 28].
Plants also produce several endogenous signaling mole-
cules that help regulate plant defense responses, including
jasmonic acid (JA), salicylic acid (SA), and ethylene (ET),
all of which are involved in complex signal transduction
networks. These biochemical molecules function coopera-
tively or antagonistically to increase plant resistance to
different pathogens [29–32]. Our study revealed that
cotton ribosomal protein L18 (GaRPL18) expression levels
can be upregulated by accumulated SA, suggesting that
RPs can mediate cotton resistance to Verticillium wilt
through the SA signaling pathway. While SA is crucial for
plant defenses and acquired systemic resistance, it is pre-
dominantly involved in the former [33, 34]. Increased SA
levels in plant pathogen-challenged tissues and applica-
tions of exogenous SA induce the expression of pathogen-
esis-related (PR) genes, thereby enhancing resistance to
invading pathogens [35, 36]. The activation of plant
immune responses is also associated with increases in the
production of reactive oxygen intermediates and nitric
oxide (NO) levels [37]. While the signal transduction
networks underlying all plant response mechanisms are
complex, crosstalk between the different signaling mole-
cules and networks provides plants with a powerful means
of regulating immune responses [38, 39].
In this study, we focused on determining whether
GaRPL18 is important for cotton resistance to Verticil-
lium wilt caused by V. dahliae. Our objective was also
to identify the signaling pathway associated with cotton
defense responses. To verify the expression of GaRPL18,
we harvested G. arboreum ‘HuNanChangDeTieZiMian’
samples at different time points after treatments with V.
dahliae, methyl jasmonate (MeJA), SA, or ET. We
observed that the GaRPL18 expression level increased
significantly following V. dahliae and SA treatments.
Moreover, we used virus-induced gene silencing (VIGS)
Gong et al. BMC Plant Biology (2017) 17:59 Page 2 of 15
technology and transgenic Arabidopsis thaliana lines
overexpressing GaR PL18 to functionally characterize
GaRPL18 in cotton. Complementary physiology and
molecular experiments confirmed that GaRPL18 signifi-
cantly con tributes to cotton resistance against the fungal
wilt pathogen V. dahliae via a mechanism related to the
SA signaling pathwa y. Our findings provide insights into
the molecular features and functions of a cotton RP gene
related to increased resistance to Verticillium wilt.
Methods
Plant sources and growth conditions
Seeds of G. arboreum ‘HuNanChangDe TieZiMian’ (resist-
ant) and ‘NaShangQuXiaoHua ’ (susceptible) were obtained
from the Institute of Cotton Research of the Chinese Acad-
emy of Agricultural Sciences. The GaRPL18 overexpression
vector (i.e., 35S::GaRPL18) was inserted into wild-type
(WT) A. thaliana Columbia ecotype (Col-0) plant. The
transgenic plants transformed with 35S::GaRPL18 were
grown in a greenhouse at 22 °C and 60% relative humidity
under a 16-h light/8-h dark photoperiod. The seeds from
different G. arboreum cultivars were incubated in another
greenhouse at 25 °C and 80% relative humidity under a 16-
h light/8-h dark photoperiod.
Culturing of Verticillium dahliae and inoculation of plants
An antagonistic defoliating Verticillium dahliae isolate
(Vd07038) was grown on potato dextrose agar medium
at 25 °C for 6 days. Colonies were then cultured in Cza-
pek’s medium [3% (w/v) sucrose, 0.2% (w/v) NaNO
3
,
0.05% (w/v) MgSO
4
·7H
2
O, 0.05% (w/v) KCl, 0.002% (w/
v) FeSO
4
·7H
2
O, and 0.131% (w/v) KH
2
PO
4
] for 5–7
days at 25 °C with shaking (150 rpm). For V. dahliae
treatments, 10 ml conidial suspensions (10
7
conidia/ml
in sterile distilled water) wer e applied to the bottom of
pots containing seedlings. Similarly, A. thaliana plan ts
were grown for 20 days before a 10-ml coni dial suspen-
sion was injected into the soil using a sterile needle.
Control plants were inoculated with an equal volum e of
sterile distilled water. For in vitro treatments, seedlings
were inoculated with V. dahliae, and the extent of stunt-
ing was determined using a previously described method
[40]. Seedlings were inoculated with a 2-μl con idial sus-
pension (5 × 10
3
conidia/ml) 2 weeks after germinating.
cDNA cloning and construction of the GaRPL18
overexpression construct
Total RNA was extracted from V. dahliae-resistant G.
arboreum ‘HuNanChangDeTieZiMian’ plants using the
RNAprep Pure Plant Kit (Tiangen, Beijing, China). The
purified RNA was used as a template to prepare cDNA
with the PrimeScript™ II 1st Strand cDNA Synthesis Kit
(Takara, Dalian, China). The 450-bp full-length
GaRPL18 coding sequence with XbaIandAscI linkers
was cloned using the primers GaRPL18-F and GaRPL18-R
(Table 1). For overexpression studies, the 35S::GaRPL18
vector was constructed by digesting the GaRPL18 coding
Table 1 primers used in the research
Primer name Forward and reverse primers(5’-3’)
GaRPL18-F TCTAGAATGAAGCTTTGGGCCACCAA
GaRPL18-R GGCGCGCCCATAAACAAGTTGGGTTT
VGaRPL18-F ACTAGTATGAAGCTTTGGGCCACCAA
VGaRPL18-R GGCGCGCCCATAAACAAGTTGGGTTT
QGaRPL18-F AATGAAGTCCGTGCCAAATCCAAG
QGaRPL18-R CGGAGCCAAATGCCGTAGTTCTTTC
Gahistone3-F AAGACTGATTTGCGTTTCCA
Gahistone3-R GCGCAAAGGTTGGTGTCTTC
AtUBQ10-F AACTTTGGTTTGTGTTTTGG
AtUBQ10-R TCGACTTGTCATTAGAAAGAAAGAGATAA
V-QPCR-F AACAACAGTCCGATGGATAATTC
V-QPCR-R GTACCGGGCTCGAGATCG
PAL-F TGGTGGCTGAGTTTAGGAAA
PAL-R TGAGTGAGGCAATGTGTGA
4CL-F ATTCAAAAGGGAGATGCC
4CL-R GAGAAGGGCAAAGCAACA
Basic chitinase-F CTTAGCCCAAACTTCCCA
Basic chitinase-R TACATTGAGTCCACCGAGAC
β-1, 3-glucanase-F CACAGGTGCTGAAGTTGGT
β-1, 3-glucanase-R CGATGGAGGGAAAGATGA
Cadinene synthase-F TAACAACAATGATGCCGAGAA
Cadinene synthase-R ATGGTCCAAAGATGCTACTGC
AtORA59-F TCATTTGACCAATCCTTCCTTT
AtORA59-R CCGTTTCCRCACRCCTCTGTAT
AtPDFl.2-F ACCCTTATCTTCGCTGCTCTTG
AtPDFl.2-R ATGTCCCACTTGGCTTCTCG
AtVSP2-F CTTTCACTTCTCTTGCTCTTGGC
AtVSP2-R GCAGTTGGCGTAGTTGATGGA
AtNPRl-F GGCTTGCGGAGAAGACGAC
AtNPRl-R ACGACGATGAGAGAGTTTACGG
AtPRl-F GCTACGCAGAACAACTAAGAGGC
AtPRl-R CCAGACAAGTCACCGCTACC
AtPR3-F GAGACACCGCCACGAGGAA
AtPR3-R TTGCTTGAAACAGTAGCCCCAT
AtAC02-F TGTTCCTCCTCTCAACCACTC
AtAC02-R CCGACATCCTGTTTCCTTCT
AtEIN3-F TCAAGGCTTTGTTTATGGGATTA
AtEIN3-R GCAAGGTATGAGGAGTCGGTC
AtERFl-F GAGAATGACCAATAAGAAGACGAA
AtERFl-R CTCCCAAATCCTCAAAGACAAC
F Forward primer, R Reverse primer
Gong et al. BMC Plant Biology (2017) 17:59 Page 3 of 15
sequence with XbaIandAscI (BioLabs). The digested
sequence was then inserted into a modified pCAM-
BIA3300 (Cambia) plant binary vector containing the glu-
fosinate (Basta) resistance gene. This vector was used to
transform Agrobacterium tumefaciens strain GV3101
using a freeze–thaw method.
Bioinformatics analysis
We used the National Center for Biotechnology Infor-
mation online BLAST tool to analyze the GaRPL18
sequence (https://bla st.ncbi.nlm.nih.gov/Blast.cgi). The
Gene Structure Display Server 2.0 was then used to
analyze gene structures. We also used the ExPASy online
tool (http://web.expasy.org/compute_pi/) to predict the
isoelectric point and molecular weight. An image of the
3D structure was developed with the PyMOL program
(http://www.pymol.org/).
Generation of the virus-induced gene silencing construct
and pathogen inoculation
We used Cotton leaf crumple virus (CLCrV)-based
vectors (i.e., pCLCr VA and pCLCrVB) for VIGS, with
CLCrV:CHLI (encoding magnesium chelatase subunit I)
as a positive control [41, 42]. The GaRPL18 fragment
was amplified by polymerase chain reaction (PCR) using
‘HuNanChangDeTieZiMian’ cDNA and the VGaRPL18-
F/VGaRPL18-R primers (Table 1). The PCR product was
digested with SpeI and AscI (BioLabs) and inserted into
the pCLCrVA vector. The constructs (i.e., pCLCrVA-
GaRPL18, pCLCrVA, and pC LCrVB) were then used to
transform A. tumefaciens strain GV3101. The cotyledons
of 7-day-old Verticillium wilt-resistant cotton seedlings
were then injected with equal amounts of CLCrV
vectors. After a 24-h incubation in darkness, the cotton
seedlings were transferred to the greenhouse and inocu-
lated with V. dahliae,10 days after the vector infiltration.
Arabidopsis thaliana transformation and molecular
analysis
Agrobacterium tumefaciens strain GV3101 containing
the GaRPL18 overexpression vector was used to trans-
form Arabidopsis Col-0 via the floral dip method [43].
The T
0
transgenic seeds were then spread evenly over
soil in a pot. After 1 week, seedlings were sprayed with
0.1% Ba sta to select positive transformants. The false-
positive seedlings turned yellow before dying. Transgenic
seeds of the T
1
generation were selected on plates of
Murashige and Skoog (MS) medium containing 0.1%
Basta. After a few days, lines with segregation ratios of
approximately 3:1 (i.e., Basta resistant: Basta sensitive)
were used to generate T
2
lines. The transgenic seeds of
the T
2
generation were also selected on MS medium
containing Basta to identify T
3
homozygous lines. The
T
3
lines with the transgene and the correct segregation
ratio were detected based on quantitative reverse transcrip-
tion (qRT)-PCR analysis of GaRPL18 expression. Only
stable homozygous T
4
lines exhibiting high GaRPL18 ex-
pression levels were chosen for further functional analyses.
Quantitative reverse transcription polymerase chain
reaction
We extracted total RNA from the roots and leaves of
cotton plants as well as from the leaves of GaRPL18-
overexpressing A. thaliana and WT plants using the
RNAprep Pure Plant Kit. The RNA was used to prepare
cDNA with the PrimeScript™ RT Reagent Kit with
gDNA Eraser (Perfect Real Time; Takara). The Gahis-
tone3 (Cotton_A_11188) and ubiquitin10 (accession:
At4g05320) genes were used as internal controls for cot-
ton and A. thaliana, respectively. We designed all qRT-
PCR primers with the Primer Premier 6.0 program
(Table 1). Diluted cDNA was used as the template for
the qRT-PCR, which was conducted with SYBR
®
Premix
Ex Taq™ (Tli RNaseH Plus; Takara) and an ABI 7900
qRT-PCR System (Applied Biosystems, CA, USA). The
three-step method involved the following PCR condi-
tions: 40 cycles of 95 °C for 30 s, 95 °C for 5 s, and 60 °
C for 30 s. We analyzed the dissociation curves for each
reaction and used the 2
−ΔΔCT
method [44] to calculate
the expression level of each target gene. All reactions
were conducted with at least three biological replicates.
Quantification of Verticillium dahliae colonization
We used a previously described qRT-PCR approach to
detect and quantify V. dahliae colonization. The qRT-
PCR analysis with the V-QPCR-F and V-QPCR-R primer
pair (Table 1) was completed as previously described [45].
Methyl jasmonate, salicylic acid, and ethylene treatments
Plants were treated with 1 mM MeJA, SA, or ET solutions.
Cotton or A. thaliana seedlings were grown in pots incu-
bated in a greenhouse. They were sprayed with different
solutions at the foliar stage. Control plants were treated
with water at the same pH.
Measurements of free salicylic acid, nitric oxide, H
2
O
2
,
and catalase levels
The abundance of the immune system-related molecules
SA, NO, H
2
O
2
, and catalase (CAT) was monitored using
different methods. The free SA content was determined
via the Rigol L3000 high performance liquid chromatog-
raphy syste m (Beijing, China) as previously described
[46]. We ground leaf samples in liquid nitrogen for
subsequent measurements of NO, H
2
O
2
, and C AT levels
using a Quantitative Assay Kit (Nanjing Jiancheng,
Beijing, China).
Gong et al. BMC Plant Biology (2017) 17:59 Page 4 of 15
Cell death assay
Plant cell death was visualized with trypan blue staining
as previously described with several modifications [47].
Leaves were soaked in trypan blue dye (1 g phenol, 1 mg
trypan blue, 1 ml lactic acid, and 1 ml glycerol dissolved
in 1 ml sterile distilled water) and then stained by boil-
ing. After cooling to room temperature, samples were
decolorized with a chloral hydrate solution (2.5 g/ml).
Verticillium dahliae recovery assay
To determine the effects of a V. dahliae infection on
cotton and A. thaliana plants, we analy zed stem frag-
ments from the first stem node. The cotton and A. thali-
ana stems were 4.5 cm and 3 cm long, respectively. The
stems were cleaned according to a previously described
method [48], and then sliced into six parts. The stem
fragments were placed on potato dextrose agar in plates,
which were incubated at 25 °C. Plant susceptibility to
infection was defined according to the number of stem
sections from which the fungus grew.
Analysis of the disease index, stunting, and chlorosis
For cotton plants, the disease index (DI) was calculated
according to the following formula: DI = [(∑disease
grades × number of infected plants)/(total checked
plants × 4)] × 100%. Seedlings were classified into five
grades (i.e., grade 0, 1, 2, 3, and 4) according to the
symptoms on the cotyledons and true leaves [49, 50].
The disease severity for A. thaliana plants was graded
on a 0–5 scale, and the DI was calculated with the fol-
lowing formu la as previously described [40]: DI = [(∑dis-
ease grades × number of infected plants)/(total checked
plants × 5)] × 100%. The DI represents a comprehensive
and objective measure of plant health, with high DI
values corresponding to serious infections. The extent of
stunting wa s rated on a 0– 3 scale (0 = no stunting; 1 =
moderate reduction in leaf area; 2 = considerable de-
crease in leaf area; and 3 = considerable decrease in leaf
area, leaf number, and stem length). Leaf chlorosis was
rated on a 0–4 scale (0 = no symptoms; 1 = up to 25%
chlorotic leaves; 2 = up to 50% chlorotic leaves; 3 = up to
75% chlorotic leaves; and 4 = up to 100% chlorotic
leaves) [40].
Results
Analysis of GaRPL18 structure and expression patterns in
cotton plants treated with Verticillium dahliae or
hormones
Based on the results of an unpublished transcriptomics
analysis of disease responses in G. arboreum plants, we
analyzed GaRPL18 fragment sequences. ‘HuNanChang-
DeTieZiMian’ and ‘NaShangQuXiaoHua’ plants are re-
sistant and susceptible to Verticillium wilt, respectively.
We cloned the 1211-bp full-length GaRPL18 sequence
using the GaRPL18-F and GaRPL18-R primers (Table 1)
along with ‘HuNanChangDeTieZiMian’ cDNA. GaRPL18
was mapped to chromosome Ca3. It was localized to the
complementary strand of the reference genome between
positions 22987558 bp and 22988768 bp. The Gene
Structure Display Server 2.0 program was used to
analyze gene structures. Exons and introns are displayed
as colored boxes and green lines, respectively (Fig. 1a).
GaRPL18 contains two introns as well as three exons
that are 49, 64, and 450 bp long (from right to left). The
gene consists of a 450-bp opening reading frame encod-
ing 149 amino acids (Fig. 1a). GaRPL18 also contains a
conserved ribosomal_L18ae domain sequence (indicated
with a blue box in Fig. 1a). The theoretical isoelectric
point and molecular weight of the encoded protein were
calculated as 10.46 and 17.9KDa, respectively, according
to the ExPASy online tool. The 3D structure revealed
that the ribosomal_L18ae domain (indicated in blue in
Fig. 1b) is largely composed of beta turns and alpha
helices. Because the GaRPL18 function is unknown,
especially in V. dahliae -infected cotton plants, we exam-
ined GaRPL18 expression patterns in samples harvested
from Verticillium wilt-resistant and -susceptible cotton
lines at different time points after inoculations. The
GaRPL18 expression levels were stable over the duration
of the experiment in the control plants treated with
water (Fig. 1c, d). In contrast, GaRPL18 expression levels
fluctuated in the susceptible cotton plants. Additionally,
in the Verticillium wilt-resistant cotton plants treated
with V. dahliae, GaRPL18 expression was considerably
upregulated at 6 h after inoculation, and peaked after
12 h, in both roots and leaves. To identify the signal
pathway associated with GaRPL18, we examined the
GaRPL18 expression patterns in hormone-treated
‘HuNanChangDeTieZiMian’ plants. We observed that
GaRPL18 expression was differentially affected by the
plant hormones. GaRPL18 expression was rapidly
induced, reaching a peak level at 6 h after treatment,
following the application of exogenous SA, but remained
at baseline levels following MeJA or ET treatments
(Fig. 1e). These results suggest that GaRPL18 enhances
the resistance of cotton to V. dahliae, and affects the
SA-mediated signaling pathway.
Interactions between GaRPL18 and PR genes
To further clarify the effects of GaRPL18 on Verticillium
wilt resistance in cotton plants, we monitored the
expression levels of PR genes at different time points
after wilt-resistant cotton plants were inoculated with V.
dahliae. Phenylpropanoid metabolism is critical for cot-
ton defense responses, and involves the core genes
phenylalanine ammonia lyase (PAL; Cotton_A_00465)
and 4-coumarate: CoA ligase (4CL; Cotton_A_0 2864)
[51]. In leaf tissue, the expression levels of the
Gong et al. BMC Plant Biology (2017) 17:59 Page 5 of 15