Showing papers by "Rural Development Administration published in 2004"

Rice Mutant Resources for Gene Discovery

Abstract: With the completion of genomic sequencing of rice, rice has been firmly established as a model organism for both basic and applied research. The next challenge is to uncover the functions of genes predicted by sequence analysis. Considering the amount of effort and the diversity of disciplines required for functional analyses, extensive international collaboration is needed for this next goal. The aims of this review are to summarize the current status of rice mutant resources, key tools for functional analysis of genes, and our perspectives on how to accelerate rice gene discovery through collaboration.

Gene Loss and Movement in the Maize Genome

Abstract: Maize (Zea mays L. ssp. mays), one of the most important agricultural crops in the world, originated by hybridization of two closely related progenitors. To investigate the fate of its genes after tetraploidization, we analyzed the sequence of five duplicated regions from different chromosomal locations. We also compared corresponding regions from sorghum and rice, two important crops that have largely collinear maps with maize. The split of sorghum and maize progenitors was recently estimated to be 11.9 Mya, whereas rice diverged from the common ancestor of maize and sorghum ∼50 Mya. A data set of roughly 4 Mb yielded 206 predicted genes from the three species, excluding any transposon-related genes, but including eight gene remnants. On average, 14% of the genes within the aligned regions are noncollinear between any two species. However, scoring each maize region separately, the set of noncollinear genes between all four regions jumps to 68%. This is largely because at least 50% of the duplicated genes from the two progenitors of maize have been lost over a very short period of time, possibly as short as 5 million years. Using the nearly completed rice sequence, we found noncollinear genes in other chromosomal positions, frequently in more than one. This demonstrates that many genes in these species have moved to new chromosomal locations in the last 50 million years or less, most as single gene events that did not dramatically alter gene structure.

Fenpyroximate resistance in Tetranychus urticae (Acari: Tetranychidae): cross-resistance and biochemical resistance mechanisms.

Abstract: A field colony of the Two-spotted spider mite, Tetranychus urticae (Koch), resistant to fenpyroximate was further selected with fenpyroximate 5SC for 20 generations at a selection pressure of 30-50% mortality (designated as FR-20 strain). Resistance and cross-resistance levels of the FR-20 strain to 18 acaricides were determined using a spray method. The FR-20 strain was extremely resistant to fenpyroximate [resistance ratio (RR) 252]. The strain exhibited extremely strong positive cross-resistance to acrinathrin (RR 196), and high levels of resistance to benzoximate (RR 55) and propargite (RR 64). Moderate levels of cross-resistance (RR 11-40) to abamectin, fenbutatin oxide, fenpropathrin, pyridaben, pyridaben + bifenthrin and tebufenpyrad were observed. The FR-20 strain showed low levels of resistance (RR < 10) to azocyclotin, bromopropylate, chlorfenapyr, chlorfenapyr + bifenthrin, chlorfenapyr + pyridaben, dicofol, fenazaquin and milbemectin. Synergist experiments with different metabolic inhibitors revealed that piperonyl butoxide had the greatest effect on the efficacy of fenpyroximate, followed by iprobenfos and triphenyl phosphate. In a comparative assay with detoxifying enzymes, the FR-20 strain showed 2.5-fold higher activity in p-nitroanisole-O-demethylation, and 2.5- and 2.2-fold higher activities in alpha- and beta-naphthyl acetate hydrolysis, respectively. These results suggested that enhanced activities of both mixed-function oxidases and esterases likely contribute to the fenpyroximate resistance of the FR-20 strain of T urticae.

Testing the branch autonomy theory: a 13C/14C double-labelling experiment on differentially shaded branches

Abstract: The impact of a heterogeneous within-crown light environment on carbon allocation was investigated on young walnut trees trained on two branches: one left in full sunlight, the other shaded until leaf fall resulting in 67% reduction in photosynthetically active radiation. In September, the two branches were separately labelled with 14CO2 and 13CO2, respectively, so that the photosynthates from each branch could be traced independently at the same time. Although some carbon movements could be detected within 5 d in both directions (including from the shaded branch to the sun branch), between-branch carbon movements were very limited: approximately 1% of the diurnal net assimilation of a branch. At this time of the year branch autonomy was nearly total, leading to increased relative respiratory losses and a moderate growth deficit in the shaded branch. The ratio of growth to reserve storage rate was only slightly affected, indicating that reserves acted not as a mere buffer for excess C but as an active sink for assimilates. In winter, branch autonomy was more questionable, as significant amounts of carbon were imported into both branches, possibly representing up to 10% of total branch reserves. Further within-plant carbon transfers occurred in spring, which totally abolished plant autonomy, as new shoots sprouted on each branch received significantly more C mobilized from tree-wide reserves than from local, mother-branch located reserves. This allowed great flexibility of tree response to environment changes at the yearly time scale. As phloem is considered not functional in winter, it is suggested that xylem is involved as the pathway for carbohydrate movements at this time of the year. This is in agreement with other results regarding sugar exchanges between the xylem vessels and the neighbouring reserve parenchyma tissues.

Differential expression profiling of the proteomes and their mRNAs in porcine white and red skeletal muscles.

Abstract: Skeletal muscle is an heterogeneous tissue with various biochemical and physical properties of several fiber types. In this study, we carried out the comparative study of protein expression patterns in white and red muscles using two-dimensional gel electrophoresis (2-DE). From more than 500 protein spots detected on each 2-DE gel, we screened five proteins that were differentially expressed between white and red muscles. Using peptide mass fingerprint and tandem mass spectrometry analysis these proteins were identified as myoglobin, two slow-twitch isoforms of myosin light chain and two small heat shock proteins (HSP20 and HSP27). The protein levels of myoglobin, myosin light chain and HSP20 were higher in red muscle, whereas HSP27 was higher in white muscle. In addition, genes of the identified proteins were cloned and their mRNAs were examined. Positive correlations between protein content and their mRNA levels were observed in white and red muscle. These results may provide us with valuable information to understand the different expression profiling between white and red muscle at the protein level.

Efficient plant regeneration from cotyledon explants of bottle gourd (Lagenaria siceraria Standl.).

Abstract: Using cotyledon explants excised from seedlings germinated in vitro, an efficient plant regeneration system via organogenesis was established for bottle gourd (Lagenaria siceraria Standl.). Maximum shoot regeneration was obtained when the proximal parts of cotyledons from 4-day-old seedlings were cultured on MS medium with 3 mg/l BA and 0.5 mg/l AgNO3 under a 16-h photoperiod. After 3–4 weeks of culture, 21.9–80.7% of explants from the five cultivars regenerated shoots. Adventitious shoots were successfully rooted on a half-strength MS medium with 0.1 mg/l IAA for 2–3 weeks. Flow cytometric analysis revealed that most of the regenerated plants derived from culture on medium with AgNO3 were diploid.

Use of Pi5(t) markers in marker-assisted selection to screen for cultivars with resistance to Magnaporthe grisea.

Abstract: Identification of the PCR markers tightly linked to genes that encode important agronomic traits is useful for marker-assisted selection (MAS). The rice Pi5(t) locus confers broad-spectrum resistance to Magnaporthe grisea, the causal agent of rice blast disease. It has been hypothesized that the Pi5(t) locus carries the same gene as that encoded by the Pi3(t) and Pii(t) loci. We developed three PCR-based dominant markers (JJ80-T3, JJ81-T3, and JJ113-T3) from three previously identified BIBAC clones—JJ80, JJ81, and JJ113—that are linked to the Pi5(t) locus. PCR analysis of 24 monogenic lines revealed that these markers are present only in lines that carry Pi5(t), Pi3(t), and Pii(t). PCR and DNA gel-blot analysis of candidate resistance lines using JJ80-T3, JJ81-T3, and JJ113-T3 indicated that Tetep is the likely donor of Pi5(t). Of the 184 rice varieties tested, 34 carried the JJ80-T3-, JJ81-T3-, and JJ113-T3-specific bands. Disease evaluation of those 34 varieties revealed that all conferred resistance to PO6-6. The genomic structure of three of these resistant varieties (i.e., IR72, Taebaeg, Jahyangdo) is most similar to that of Pi5(t). Our results demonstrate the usefulness of the JJ80-T3, JJ81-T3, and JJ113-T3 markers for MAS for M. grisea resistance.

Repellency of aerosol and cream products containing fennel oil to mosquitoes under laboratory and field conditions

Abstract: The repellency of fennel (Foeniculum vulgare Miller)-containing products (5% aerosol and 8% cream) against mosquitoes was compared with those of citronella oil, geranium oil and deet, as well as three commercial repellents, Baby Keeper cream containing IR3535, MeiMei cream containing citronella and geranium oils, and Repellan S aerosol containing 19% N,N-diethyl-m-toluamide (deet) under laboratory and field conditions. In a laboratory study with female Aedes aegypti (L), fennel oil exhibited good repellency in a release-in-cage test and repellency in skin and patch tests of the oil was comparable with those of citronella and geranium oils. In paddy field tests with five human volunteers, 5% and 8% fennel oil-containing aerosol and cream produced 84% and 70% repellency, respectively, at 90 min after exposure, whereas Baby Keeper cream and MeiMei cream gave 71% and 57% repellency at 90 min after exposure, respectively, and Repellan S aerosol gave 89% repellency at 210 min. The species and ratio of mosquitoes collected were the genera Culex (44.1%), Anopheles (42.2%), Aedes (7.8%) and Armigeres (5.9%). Fennel oil-containing products could be useful for protection from humans and domestic animals from vector-borne diseases and nuisance caused by mosquitoes.

Agrobacterium -mediated transformation system for large-scale producion of transgenic chinese cabbage ( Brassica rapa L. ssp. pekinensis ) plants for insertional mutagenesis

Abstract: In order to better utilize insertional mutagenesis and functional genomics in Chinese cabbage, we have developed an improved transformation system that more efficiently produces a large number of transgenic plants. Hypocotyl explants were inoculated withAgrobacterium tumefaciens LBA4404. This strain harbors tagging vector pRCV2, which contains a hygromycin-resistance gene, an ampicillin resistance gene, and a bacterial replication origin within the T-DNA. Transformation efficiency was highest when the explants were first co-cultivated for 3 d in a medium supplemented with 5 mg L-1 acetosyringone, then transferred to a 0.8% agar selection medium containing 10 mg L-1 hygro-mycin. In addition, maintaining a low pH in the co-cultivation medium was critical to enhancing transformation frequency. A total of 3369 transgenic plants were obtained, with efficiencies ranging from 2.89% to 5.00%. Southern blot analysis and T, progeny tests from 120 transgenic plants confirmed that the transgenes were stably inherited to the next generation. We also conducted plasmid rescue and inverse PCR with some transformants, based on their phenotype, to demonstrate the applicability of T-DNA tagging in Chinese cabbage. The tagged sequences were then analyzed.

Agrobacterium -mediated genetic transformation of Perilla frutescens

Abstract: A reproducible plant regeneration and an Agrobacterium tumefaciens-mediated genetic transformation protocol were developed for Perilla frutescens (perilla). The largest number of adventitious shoots were induced directly without an intervening callus phase from hypocotyl explants on MS medium supplemented with 3.0 mg/l 6-benzylaminopurine (BA). The effects of preculture and extent of cocultivation were examined by assaying β-glucuronidase (GUS) activity in explants infected with A. tumefaciens strain EHA105 harboring the plasmid pIG121-Hm. The highest number of GUS-positive explants were obtained from hypocotyl explants cocultured for 3 days with Agrobacterium without precultivation. Transgenic perilla plants were regenerated and selected on MS basal medium supplemented with 3.0 mg/l BA, 125 mg/l kanamycin, and 500 mg/l carbenicillin. The transformants were confirmed by PCR of the neomycin phosphotransferase II gene and genomic Southern hybridization analysis of the hygromycin phosphotransferase gene. The frequency of transformation from hypocotyls was about 1.4%, and the transformants showed normal growth and sexual compatibility by producing progenies.

Mapping of Quantitative Trait Loci for Cold Tolerance in Weedy Rice

Abstract: A quantitative trait locus (QTL) analysis was carried out with a recombinant inbred line (RIL) population to identify the chromosomal regions responsible for cold tolerance of rice (Oryza sativa L.). The RIL population, consisting of 80 lines, was developed from a cross between the indica cultivar, Milyang 23 and the japonica weedy rice, Hapcheonaengmi 3. The population was genotyped with 2 morphological and 132 DNA markers, providing an average interval size of 11.3 cM, and was also evaluated for traits related to agricultural performance in cold water and in control plots. The RILs showed delayed heading and reduced culm length in the cold water plot and the differences in heading date and culm length between two plots were statistically significant. Cold tolerance was measured as days to heading, culm length, spikelet fertility, leaf discoloration, and panicle exsertion in the cold water plot, and difference in days to heading and the reduction ratio of culm length between two plots. A total of 14 QTLs for 7 traits were identified using single point and composite interval analysis. The number of QTLs per trait ranged from one to three. Phenotypic variation associated with each QTL ranged from 5.8 to 32.8%. No digenic interaction was detected. Several QTLs associated with cold tolerance were clustered in a few chromosomal blocks. For 11 (78.6%) of the QTLs identified in this study, the Hapcheonaengmi 3-derived alleles contributed desirable effects and favorable alleles were detected for difference in days to heading, spikelet fertility, panicle exsertion and leaf discoloration. From this study, it can be concluded that weedy rice is useful as a source of valuable alleles for breeding cold tolerance in rice.

Identification of fungal (Magnaporthe grisea) stress-induced genes in wild rice (Oryza minuta)

Abstract: To identify fungal stress-related genes in wild rice, Oryza minuta, we constructed a subtracted library using suppression subtractive hybridization in combina- tion with mirror orientation selection. DNA chips con- taining 960 randomly selected cDNA clones were applied by reverse Northern analysis to eliminate false positive clones from the library and to prescreen differentially expressed genes. In total, 377 cDNA clones were selected on the basis of their signal intensities and expression ratios. Sequence analyses of these 377 cDNA fragments revealed that 180 of them (47.7%) represented unique genes. Of these180 cDNAs, 89 clones (49.6%) showed significant homologies to previously known genes, while the remaining 91 did not match any known sequences. The putative functions of the 180 unique ESTs were categorized by aligning them with MIPS data. They were classified into seven different groups using microarray data-derived expression patterns and verified by Northern blotting.

Circadian regulation of rice (Oryza sativa L.) CONSTANS-like gene transcripts

Abstract: We identified three rice cDNA clones showing amino acid similarity to the Arabidopsis CONSTANS-like proteins from a database search (S12569, S3574, and C60910), to examine if their transcript abundances were under circadian control. Unlike the other two proteins, the protein encoded by the S12569 cDNA contains only one CONSTANS-like zinc finger B box, and a CCT region. We found that the transcript levels of these rice CONSTANS-like (COL) genes were under circadian control. The oscillation phase of the S12569 gene transcript was more or less opposite to those of OsGI (rice GIGANTEA homolog) and Hd1 (rice COSTANS homolog), whereas the phases of the other two gene transcripts were similar to that of the Hd1 transcript. S12569 mRNA started to increase about 3 h after the onset of the dark period, with a peak about 3 h after its end. The S3574 and C60910 genes were expressed to similar extents during the vegetative and reproductive phases, like OsGI. Higher levels of S12569 transcripts, however, like those of Hd1, were detected in the earlier stages of panicle development. Unlike Hd1 transcripts, S12569, S3574, and C60910 transcripts were present at similar levels in the aerial parts of plants and in their roots during the vegetative phase. In conclusion, the rice COL genes showed distinctive expression patterns from the CO and COL genes, as well as Hd1, a rice CO homolog.

Cytology of cork layer formation of citrus and limited growth of Elsinoe fawcettii in scab lesions

Abstract: Ultrastructural aspects of host–parasite interactions were investigated in fruits and leaves of citrus (satsuma mandarin) infected with Elsinoe fawcettii. Fungal infection induced host tissues to form cork layers bordering the necrotic areas below the infected sites. The cork layers were composed of compact host cells with convoluted cell walls and alternating lamellations, indicating ligno–suberized tissues in the wound periderm. No host tissues below the cork layers were invaded by hyphae. Hyphae grew intercellularly and intracellularly, often causing hypertrophy and compartmentalization of infected host cells. Also, host cells adjacent to invading hyphae showed accumulation of electron-dense materials and the formation of host cell wall protuberances in intercellular spaces. Hyphae had concentric bodies that showed an electron-transparent core surrounded by an electron-dense layer with radiating filamentous structures on their surface. One or more intrahyphal hyphae were found in the cytoplasm of intercellular or intracellular hyphae. These results suggest that the ligno–suberized cork layers in the wound periderm of citrus act as a protective barrier, which leads to restricted growth of E. fawcettii in bordered scab lesions. The fungus is thought to form concentric bodies and intrahyphal hyphae as a survival mechanism against the water- and nutrient-deficient environments that occur in the cork layers of necrotic host parts.

Cellular characteristics of primary and immortal canine embryonic fibroblast cells.

Abstract: Using normal canine embryonic fibroblasts (CaEF) that were shown to be senescent at passages 7th-9th, we established two spontaneously immortalized CaEF cell lines (designated CGFR-Ca-1 and -2) from normal senescent CaEF cells, and an immortal CaEF cell line by exogenous introduction of a catalytic telomerase subunit (designated CGFR-Ca-3). Immortal CGFR- Ca-1, -2 and -3 cell lines grew faster than primary CaEF counterpart in the presence of either 0.1% or 10% FBS. Cell cycle analysis demonstrated that all three immortal CaEF cell lines contained a significantly high proportion of S-phase cells compared to primary CaEF cells. CGFR-Ca-1 and -3 cell lines showed a loss of p53 mRNA and protein expression leading to inactivation of p53 regulatory function, while the CGFR-Ca-2 cell line was found to have the inactive mutant p53. Unlike the CGFR-Ca-3 cell line that down-regulated p16INK4a mRNA due to its promoter methylation but had an intact p16INK4a regulatory function, CGFR-Ca-1 and -2 cell lines expressed p16INK4a mRNA but had a functionally inactive p16INK4a regulatory pathway as judged by the lack of obvious differences in cell growth and phenotype when reconstituted with wild-type p16INK4a. All CGFR-Ca-1, -2 and -3 cell lines were shown to be untransformed but immortal as determined by anchorage-dependent assay, while these cell lines were fully transformed when overexpressed oncogenic H-rasG12V. Taken together, similar to the nature of murine embryo fibroblasts, the present study suggests that normal primary CaEF cells have relatively short in vitro lifespans and should be spontaneously immortalized at high frequency.

Isolation and Characterization of Cellulase Secreting Bacterium from Cattle Manure: Application to Composting

Abstract: A extracellular cellulase producing bacterium was isolated from cow feces, and was identified to be Bacillus licheniformis on the basis of morphological and biochemical properties as well as the composition of cellular fatty acids composition (FAME). CMCase, FPase and avicelase activities of the isolates cultured in CMC media at 37°C for 24 hrs were 1.65 U/ml, 0.13 U/ml and 0.18 U/ml, respectively. However, β-glucosidase activity was not detected. The optimum pH and temperature for induction of the enzyme were 7.5 and 50°C. The maximum CMCase activity was observed at pH 7.5 and 75°C. Zymogram analysis for crude supernatant showed four major bands CMC-SDS-PAGE. By adding 0.1% DMP (Developed Microbial Product) -comp including B. licheniformis NLRI X-33, microbial product, to swine manure composting pile, the gab of composting temperature within the pile in DMP-comp and control was 23°C and 34°C, respectively, during the initial 23 day composting periods. Coliforms were not found in the swine + sawdust sampl...

The Role of BF-7 on Neuroprotection and Enhancement of Cognitive Function

Abstract: Amyloid β-peptide (Aβ) contributes to the pathogenesis of Alzheimer's disease (AD), causing neuronal death through apoptosis. In this study, the neuroprotective role of BF-7, extracted form sericultural product, was examined against Aβ -induced toxicity in cultured human neuronal cell SKN-SH. In order to know if the BF-7 has positive role on the cognition and memory in human, the mixture of BF-7, DHA and EPA (BDE) was examined using Rey Kim and K-WAIS test with 50 healthy high school student. We report here that BDE significantly attenuated Aβ-induced apoptosis through the reduction of ROS accumulation, and diminished caspase-like protease activity. Moreover, the memory index and memory preservation, and attentative concentration of BDE treated group for 1 month were significantly improved, in contrast to the case of placebo control treated with DHA and EPA. This result represent that the BF-7 play significant positive role on learning memory. Taken together, our result suggested the natural product BF-7 is a good substance for the brain functionally and physiologically.

Comparative analysis of 5,211 leaf ESTs of wild rice (Oryza minuta).

Abstract: The expressed sequence tags (ESTs) presented in this report are the first transcriptomes of wild rice. A cDNA library was constructed from 4-week-old leaf samples of greenhouse-grown Oryza minuta. The 5,211 cDNA clones of O. minuta represent 3,401 unique sequences, consisting of 2,787 singletons and 614 assembled sequences. Database comparisons of the cDNAs in GenBank’s non-redundant databases using BLAST revealed that 4,957 of the 5,211 cDNAs (95.1%) showed a high degree of sequence homology to genes from other organisms. Most of the transcripts identified were genes related to metabolism, energy, protein biosynthesis and subcellular localization. The metabolism and energy categories of the O. minuta ESTs showed a considerably higher gene expression level than those of O. sativa ESTs. These data and genes can be utilized in rice breeding.

Establishment of life-span extended bovine fibroblast cells carrying the characterization of primary cells.

Abstract: Although primary bovine embryonic fibroblast (BEF) cells have previously been used as nucleus-donors for nuclear transfer (NT), it has now been proposed to use BEF cells to generate cloned cows that were genetically modified by transgenic or a knock-out system A major limitation to gene targeting somatic cells, however, is the overall life-span of the cell In this study, we first examined in vitro life-span of primary BEF cells Primary BEF cells were found to be replicative senescent at passage 10th-12th, similar to primary murine embryonic fibroblast cells To overcome this short in vitro life-span, we have optimized culture conditions to extend the life-span and determined growth characteristics of BEF cell lines Two life-span extended BEF cell lines (designated CGFR -BO-1 and CGFR-BO-2) were shown to grow much faster than their parental primary counterparts Both cell lines did not display any potential for abnormal growth such as foci formations in either soft-agar or confluent culture condition In cloning experiments using these cell lines as a nuclear donor, the reconstructed karyoblasts underwent apoptosis, reprogramming and development in the blastocyst stage, at a similar frequency to those observed with parental as well as adult primary fibroblasts Furthermore, these cell lines targeted with green fluorescence protein (GFP) were successfully transduced, selected and reprogrammed by NT to develop into a blastocyst stage with GFP expression Our results suggested methods to extend life-span of donor cells with tremendous implications for the genetic engineering of bovine fibroblast cells

Identification of genes induced in wound-treated wild rice (Oryza minuta).

Abstract: A subtracted library was constructed from wound-treated wild rice (Oryza minuta) by suppression subtractive hybridization (SSH) in combination with mirror orientation selection (MOS). To distinguish between differentially expressed transcripts and false positive clones, DNA chips containing 960 random clones were applied as a form of reverse Northern screening. Based on the signal intensities and expression ratios obtained from experiments performed in triplicate, 371 clones were selected. ESTs produced from the subtracted library showed 63.2% redundancy, and 72% of all clones could be matched to the GenBank nonredundant database. Functional categorization placed the identified enriched genes in categories of subcellular localization, metabolism, cell rescue and defense, and transcription. These EST-related resistance mechanisms could be used in investigations into the defense mechanisms of wild species, and to provide new routes to improving the germplasm of cultivated rice.

Phylogenetic analysis of plastid trnL-trnF sequences from Arisaema species (Araceae) in Korea

Abstract: The phylogeny of 10 taxa belonging to three sections of Arisaema (Pistillata, Tortuosa, and Arisaema) distributed in Korea and an outgroup taxon (Pinellia ternate) was analyzed by comparing the trnL(UAA)-trnF(GAA) intergenic spacer sequences of the chloroplast DNA (cpDNA). The trnL-trnF regions ranged from 336 to 396 base pairs (bp) in length. Sequence alignment required 18 base substitutions and 4 independent indels in the region. The longest length mutation was a 35-bp deletion in A. thunbergii, A. heterophyllum, A. urashima, and A. candidissimum. Two different restriction fragment patterns were seen with MspI digestions. Section Tortuosa (A. thunbergii and A. heterophyllum) plus A. urashima and A. candidissium were distinguished from the others. In addition, 16-bp deletions were found in A. thunbergii, A. heterophyllum, and A. candidissimum. Four species possessed a 24-bp insertion mutation with a duplication motif, TTTTGTTAGGTTATCCTTACACTT:A. amurense f. serratum, A. robustum f. purpureum, A. peninsulae, and A. sikokianum. A maximum parsimony analysis of 11 accessions produced 12 equally most-parsimonious (MP) trees. The MP trees also contained three independent groups. Group I contained one taxon:A. ringens f. praecox. Group II contained the section Tortuosa accessions including A. urashima and A. candidissimum. Group III contained the section Arisaema and A. sikokianum. These results show that analyses of the cpDNA trnL-trnF intergenic spacer are a useful approach for inferring phylogenetic relationships and identification within the genus Arisaema, distributed in Korea.

An RAPD marker linked to the pollen sterility gene ps in peach (Prunus persica)

Abstract: Pollen sterility in peach (Prunus persica [L.] Batsch) is known to be determined by a single gene pair Ps/ps with pollen sterility recessive to pollen fertility. Crossing of pollen-fertile ‘Yumyeon...

Breeding of Flammulina velutipes Strains Adaptable to Elevated-temperature

Abstract: Winter mushroom, Flammulina velutipes, needs low temperature during its cultivation. To save on farm costs, especially during summer, a strain adaptable to a higher or elevated-temperature must be ...

Characterization of a RAPD Fragment Unique to Species with Hairy Fruit Skin in the Genus Actinidia

Abstract: To develop a SCAR primer related to the hairy-fruit trait in the genusActinidia, we took a PCR-RAPD approach using arbitrary 10-mer primers. PCR with the UBC 376 primer generated specific fragments from three species with hairy fruit skin. Those fragments were then cloned to determine their nucleotide sequences. Two SCAR primers were designed from the UBC 376 primer and nucleotide sequences were obtained from the PCR fragments. A SCAR primer, OKC385, specifically amplified a 385-bp fragment from one clone ofActinidia eriantha, four ofActinidia chinensis, and four ofActinidia deliciosa. Deduced amino acid sequences of this fragment showed high sequence homology with plant cellulose synthases, which are involved in the biosynthesis of cellulose, a major cell wall component. The 385-bp fragment was specifically detected only in the seriesPerfectae C.F. Liang of sectionStellatae Li. This type has many hairs on the leaves, fruits, and stems, suggesting that the gene containing the PCR fragment is involved in hair formation in this phylogenetic group. Taken together, our results suggest that the SCAR primer, OKC385, can be used as a specific primer for early selection of the non-hair trait in breeding of the genusActinidia.

Three‐Dimensional Reconstruction of Hematopoietic Organ of Bombyx mori Larva

Abstract: Three-dimensional reconstructions of a hematopoietic organ (HPO) from Bombyx mori larva were undertaken using light and electron microscopy Each compact islet varied in sizes, but in the central area of the HPO their size became smaller Compact islets and loose islets were made up of prohemocytes, plasmatocytes, and reticular cells, but there were differences in the proportions of these cells Within the cytoplasm of reticular cells and within their cell projection, vacuoles were observed Cell proliferation occurs primarily in the compact islets, and differentiation associated with the reticular cells occurs primarily in the loose islets It can be inferred that reticular cells have a significant influence on proliferation and differentiation associated with hematopoiesis According to the results of the 3-D reconstruction, one reticular cell is in contact with eight or nine hemocytes Each reticular cell is presumably of approximately ten hemocytes Movies relevant to Figs 3, 4 and 5 can be found at http://biotechkoreaackr/ cellbio/pages/ 3D-resultshtml