P
P. Andrew Futreal
Researcher at University of Texas at Austin
Publications - 32
Citations - 11582
P. Andrew Futreal is an academic researcher from University of Texas at Austin. The author has contributed to research in topics: Breast cancer & Tumor suppressor gene. The author has an hindex of 18, co-authored 32 publications receiving 10098 citations. Previous affiliations of P. Andrew Futreal include Howard Hughes Medical Institute & Wellcome Trust.
Papers
More filters
Journal ArticleDOI
Allele Loss on Chromosome 1p36 in Epithelial Ovarian Cancers
Angeles A. Alvarez,Anouk R. Lambers,Johnathan M. Lancaster,G. Larry Maxwell,Shazia Ali,Curtis Gumbs,Andrew Berchuck,P. Andrew Futreal +7 more
TL;DR: These findings further delineate regions on chromosome 1p36 proposed to contain tumor suppressor gene(s) that may play a role in the development and/or progression of epithelial ovarian carcinoma.
Journal ArticleDOI
Novel transcribed sequences within the BWS/WT2 region in 11p15.5 : Tissue-specific expression correlates with cancer type
Shyra J. Crider-Miller,Laura H. Reid,Michael J. Higgins,Norma J. Nowak,Thomas B. Shows,P. Andrew Futreal,Bernard E. Weissman +6 more
TL;DR: Interestingly, the tissue-specific mRNA expression of these genes correlates with the tumor types linked to this region, and this work can be compiled into a transcript map, important in the elucidation of tumor suppressor activity on chromosome 11p15.5.
Journal ArticleDOI
Localization of the VHR Phosphatase Gene and Its Analysis as a Candidate for BRCA1
Alexander Kamb,P. Andrew Futreal,Judith Rosenthal,Charles Cochran,Keith D Harshman,Qingyun Liu,Robert Phelps,Sean V. Tavtigian,Thanh Tran,Charles E. Hussey,Russell Bell,Yoshio Miki,Jeff Swensen,Maurine R. Hobbs,Jeffrey R. Marks,L. Michelle Bennett,J. Carl Barrett,Roger W. Wiseman,Donna M Shattuck-Eidens +18 more
TL;DR: The VH1-related human protein (VHR) gene was localized to human chromosome 17q21 in a region thought to contain the BRCA1 locus, a locus that confers susceptibility to breast and ovarian cancer and was screened in individuals with familial breast cancer and in sporadic breast tumor and breast cancer cell lines.
Journal ArticleDOI
Growth and transformation suppressor genes for BHK Syrian hamster cells on human chromosomes 1 and 11.
TL;DR: It is concluded that genes that suppress BHK‐cell growth in general or in agar reside on human chromosomes 1 and 11, respectively.
Supplementary file 1.
Young Seok Ju,Ludmil B. Alexandrov,Moritz Gerstung,Inigo Martincorena,Serena Nik-Zainal,Manasa Ramakrishna,Helen Davies,Elli Papaemmanuil,Gunes Gundem,Adam Shlien,Niccolo Bolli,Sam Behjati,P. S. Tarpey,Jyoti Nangalia,Charles E. Massie,Adam P. Butler,Jon W. Teague,George S. Vassiliou,Anthony R. Green,Ming-Qing Du,Ashwin Unnikrishnan,John E. Pimanda,Bin Tean Teh,Nikhil C. Munshi,Mel Greaves,Paresh Vyas,Adel K. El Naggar,Tom Santarius,V. Peter Collins,Richard Grundy,Jack A. Taylor,D. Neil Hayes,David Malkin,Christopher S. Foster,Anne Y. Warren,Hayley C. Whitaker,Daniel Brewer,Rosalind Eeles,Colin Cooper,David E. Neal,T. Visakorpi,W. Isaacs,G. Steven Bova,Adrienne M. Flanagan,P. Andrew Futreal,Andy G. Lynch,Patrick F. Chinnery,Ultan McDermott,Michael R. Stratton,Peter J. Campbell +49 more
TL;DR: I) duplexing the oligos: a) Order the oligo the following way: Example target sequence: 5’CCCAGGTATTGTTAGCGGTTTGAACGCTGCGTTTT3’ and add GATCA to the 3’ end of the reverse oligo (see the colored sequences below).