Showing papers in "Nucleic Acids Research in 1989"
4,138 citations
TL;DR: Using a set of synthetic oligonucleotides homologous to broadly conserved sequences in-vitro amplification via the polymerase chain reaction followed by direct sequencing results in almost complete nucleotide determination of a gene coding for 16S ribosomal RNA.
Abstract: Using a set of synthetic oligonucleotides homologous to broadly conserved sequences in-vitro amplification via the polymerase chain reaction followed by direct sequencing results in almost complete nucleotide determination of a gene coding for 16S ribosomal RNA. As a model system the nucleotide sequence of the 16S rRNA gene of M.kansasii was determined and found to be 98.7% homologous to that of M.bovis BCG. This is the first report on a contiguous sequence information of an entire amplified gene spanning 1.5 kb without any subcloning procedures.
2,587 citations
TL;DR: The ARMS (Amplification Refractory Mutation System) as discussed by the authors is a system that allows genotyping solely by inspection of reaction mixtures after agarose gel electrophoresis.
Abstract: We have improved the "polymerase chain reaction" (PCR) to permit rapid analysis of any known mutation in genomic DNA. We demonstrate a system, ARMS (Amplification Refractory Mutation System), that allows genotyping solely by inspection of reaction mixtures after agarose gel electrophoresis. The system is simple, reliable and non-isotopic. It will clearly distinguish heterozygotes at a locus from homozygotes for either allele. The system requires neither restriction enzyme digestion, allele-specific oligonucleotides as conventionally applied, nor the sequence analysis of PCR products. The basis of the invention is that unexpectedly, oligonucleotides with a mismatched 3'-residue will not function as primers in the PCR under appropriate conditions. We have analysed DNA from patients with alpha 1-antitrypsin (AAT) deficiency, from carriers of the disease and from normal individuals. Our findings are in complete agreement with allele assignments derived by direct sequencing of PCR products.
2,571 citations
TL;DR: The polymerase chain reaction (PCR) process is used to show that several randomly chosen simple sequence loci with different nucleotide composition and from different species show extensive length polymorphisms.
Abstract: Short simple sequence stretches occur as highly repetitive elements in all eukaryotic genomes and partially also in prokaryotes and eubacteria. They are thought to arise by slippage like events working on randomly occurring internally repetitive sequence stretches. This predicts that they should be generally hypervariable in length. I have used the polymerase chain reaction (PCR) process to show that several randomly chosen simple sequence loci with different nucleotide composition and from different species show extensive length polymorphisms. These simple sequence length polymorphisms (SSLP) may be usefully exploited for identity testing, population studies, linkage analysis and genome mapping.
2,428 citations
1,390 citations
TL;DR: A degree of similarity was revealed between the consensus pattern of conserved amino acid residues derived for the new superfamily and that of another recently described protein superfamily including a different set of prokaryotic, eukaryotic and viral (putative) helicases.
Abstract: In the course of systematic analysis of protein sequences containing the purine NTP-binding motif, a new superfamily was delineated which included 25 established or putative helicases of Escherichia coli, yeast, insects, mammals, pox- and herpesviruses, a yeast mitochondrial plasmid and three groups of positive strand RNA viruses. These proteins contained 7 distinct highly conserved segments two of which corresponded to the "A" and "B" sites of the NTP-binding motif. Typical of the new superfamily was an abridged consensus for the "A" site, GxGKS/T, instead of the classical G/AxxxxGKS/T. Secondary structure predictions indicated that each of the conserved segments might constitute a separate structural unit centering at a beta-turn. All previously characterized mutations impairing the function of the yeast helicase RAD3 in DNA repair mapped to one of the conserved segments. A degree of similarity was revealed between the consensus pattern of conserved amino acid residues derived for the new superfamily and that of another recently described protein superfamily including a different set of prokaryotic, eukaryotic and viral (putative) helicases.
963 citations
TL;DR: In this paper, the authors quantitatively evaluated a total of 39 E. coli strains for their tolerance to cytosine methylation in phage and plasmid cloning systems, and provided a rational basis for future construction of 'ideal' hosts combining optimal methylation tolerance with additional advantageous mutations.
Abstract: Many strains of E. coli K12 restrict DNA containing cytosine methylation such as that present in plant and animal genomes. Such restriction can severely inhibit the efficiency of cloning genomic DNAs. We have quantitatively evaluated a total of 39 E. coli strains for their tolerance to cytosine methylation in phage and plasmid cloning systems. Quantitative estimations of relative tolerance to methylation for these strains are presented, together with the evaluation of the most promising strains in practical recombinant cloning situations. Host strains are recommended for different recombinant cloning requirements. These data also provide a rational basis for future construction of 'ideal' hosts combining optimal methylation tolerance with additional advantageous mutations.
801 citations
TL;DR: A method is presented for choosing optimal oligodeoxyribonucleotides as probes for filter hybridization, primer for sequencing, or primers for DNA amplification, based on a simple dynamic algorithm.
Abstract: A method is presented for choosing optimal oligodeoxyribonucleotides as probes for filter hybridization, primers for sequencing, or primers for DNA amplification. Three main factors that determine the quality of a probe are considered: stability of the duplex formed between the probe and target nucleic acid, specificity of the probe for the intended target sequence, and self-complementarity. DNA duplex stability calculations are based on the nearest-neighbor thermodynamic values determined by Breslauer et al. [Proc. Natl. Acad. Sci. U.S.A. (1986), 83: 3746]. Temperatures of duplex dissociation predicted by the method described here were within 0.4 degrees C of the values obtained experimentally for ten oligonucleotides. Calculations for specificity of the probe and its self-complementarity are based on a simple dynamic algorithm.
783 citations
TL;DR: Using this concept, in vitro amplified plasmid DNA and chromosomal DNA were sequenced directly from single colonies and the system was found to be suitable for sequencing using both isotope- and fluorescent-labelled primers.
Abstract: Approaches to direct solid phase sequencing of genomic and plasmid DNA have been developed using magnetic beads, coated with streptavidin, as solid support. The DNA is immobilized through selective incorporation of biotin into one of the strands. A single stranded template, suitable for sequencing, is obtained through strand-specific elution. Using this concept, in vitro amplified plasmid DNA and chromosomal DNA were sequenced directly from single colonies. The solid phase approach ensures that the amplification and the sequencing reactions can be performed under optimal conditions. The system was found to be suitable for sequencing using both isotope- and fluorescent-labelled primers.
774 citations
TL;DR: A PCR aided transcript titration assay (PATTY) which is based on the co-amplification of an in vitro generated transcript differing by a single base exchange from the target mRNA which gives accurate results within 24 hours and is useful especially for the quantification of either low-abundance mRNA or more abundant mRNA present in very small amounts of total RNA.
Abstract: The polymerase chain reaction (PCR) is used as part of a new approach to the absolute quantification of mRNA. We describe a PCR aided transcript titration assay (PATTY) which is based on the co-amplification of an in vitro generated transcript differing by a single base exchange from the target mRNA. Identical portions of a total RNA sample are "spiked" with different amounts of this mutated standard RNA, converted to cDNA and amplified by PCR. Because the base exchange creates a novel restriction endonuclease site, the ratio of co-amplified DNA derived from target mRNA to amplified DNA derived from standard RNA can be determined after restriction endonuclease digestion and separation by gel electrophoresis. This method gives accurate results within 24 hours and is useful especially for the quantification of either low-abundance mRNA or more abundant mRNA present in very small amounts of total RNA. The low-abundance mRNA encoding 4-coumarate:CoA ligase (4CL) in cultured potato cells (Solanum tuberosum L.) was measured in a case study. About 100 molecules per assay could be accurately detected by the new method.
729 citations
TL;DR: The generality of the method should make it useful for the direct alteration of most cloned genes, and the only limitation may be the total length of the plasmid to be manipulated.
Abstract: We have developed a general and simple method for directing specific sequence changes in a plasmid using primed amplification by the polymerase chain reaction (PCR). The method is based on the amplification of the entire plasmid using primers that include the desired changes. The method is rapid, simple in its execution, and requires only minute amounts of plasmid template DNA. It is significant that there are no special requirements for appropriately placed restriction sites in the sequence to be manipulated. In our system the yield of transformants was high and the fraction of them harboring plasmids with only the desired change was consistently about 80%. The generality of the method should make it useful for the direct alteration of most cloned genes. The only limitation may be the total length of the plasmid to be manipulated. During the study we found that the Taq DNA polymerase used for PCR adds on a single extra base (usually an A) at the end of a large fraction of the newly synthesized chains. These had to be removed by the Klenow fragment of DNA polymerase to insure restoration of the gene sequence.
TL;DR: It is proposed that IS900, IS110, and similar insertion elements recently identified in disease isolates of Mycobacterium avium are members of a phylogenetically related family.
Abstract: The complete sequence of an insertion element IS900 in Mycobacterium paratuberculosis is reported. This is the first characterised example of a mycobacterial insertion element. IS900 consists of 1451bp of which 66% is G + C. It lacks terminal inverted and direct repeats, characteristic of Escherichia coli insertion elements but shows a degree of target sequence specificity. A single open reading frame (ORF 1197) coding for 399 amino acids is predicted. This amino acid sequence, and to a lesser extent the nucleotide sequence, show significant homologies to IS110, an insertion element of Streptomyces coelicolor A3(2). It is proposed that IS900, IS110, and similar insertion elements recently identified in disease isolates of Mycobacterium avium are members of a phylogenetically related family. IS900 will provide highly specific markers for the precise identification of Mycobacterium paratuberculosis, useful in defining its relationship to animal and human diseases.
TL;DR: Five highly conserved motifs occur in a mammalian methyltransferase responsible for the formation of 5-methylcytosine within CG dinucleotides, and can be used to discriminate the known 5- methylcytOSine forming methyltransferases from all other methyl transferases of known sequence, and from allother identified proteins in the PIR, GenBank and EMBL databases.
Abstract: Thirteen bacterial DNA methyltransferases that catalyze the formation of 5-methylcytosine within specific DNA sequences possess related structures. Similar building blocks (motifs), containing invariant positions, can be found in the same order in all thirteen sequences. Five of these blocks are highly conserved while a further five contain weaker similarities. One block, which has the most invariant residues, contains the proline-cysteine dipeptide of the proposed catalytic site. A region in the second half of each sequence is unusually variable both in length and sequence composition. Those methyltransferases that exhibit significant homology in this region share common specificity in DNA recognition. The five highly conserved motifs can be used to discriminate the known 5-methylcytosine forming methyltransferases from all other methyltransferases of known sequence, and from all other identified proteins in the PIR, GenBank and EMBL databases. These five motifs occur in a mammalian methyltransferase responsible for the formation of 5-methylcytosine within CG dinucleotides. By searching the unidentified open reading frames present in the GenBank and EMBL databases, two potential 5-methylcytosine forming methyltransferases have been found.
TL;DR: Almost all of the labelled primer is extended by the DNA polymerase and thus a shorter autoradiograph exposure is needed, and multiple LPCR cycle3 also removes sequencing artifacts.
Abstract: One of the problems associated with double-3tranded DNA sequencing is that most of the [5'-3P]-labelied oligonuoleotide primer i3 not extended by the DNA polymerase. Hence, most of the labelled primer is wasted and gels have to be autoradiographed for several days. In the method described in this paper, almost all of the labelled primer is extended by the DNA polymerase and thus a shorter autoradiograph exposure is needed. This method Is a modification of the linear polymerase chain reaction (LPCR) where only one o ligonucleotide 13 present (1). It U363 Taq DNA polymerase and, since polymerisation is at 72°C, results in a low level of sequencing artifacts. Multiple LPCR cycle3 also removes sequencing artifacts. The use of lower than normal dNTP concentrations i3 necessary to achieve
TL;DR: The available biochemical evidence is compatible with the proposal that viral proteins in which the NTP-binding pattern is evolutionarily conserved might all be NTPases involved in: i) duplex unwinding during DNA and RNA replication, transcription, recombination and repair, and possibly mRNA translation; ii) DNA packaging, and iii) dNTP generation.
Abstract: A compilation is presented of viral proteins containing the NTP-binding sequence pattern, and criteria are suggested for assessment of the functional significance of the occurrence of this pattern in protein sequences. It is shown that the distribution of NTP-binding pattern-containing proteins through the viral kingdom is strongly non-random. Sequence comparisons led to delineation of several families of these proteins, some of which could be brought together into superfamilies including also cellular proteins. The available biochemical evidence is compatible with the proposal that viral proteins in which the NTP-binding pattern is evolutionarily conserved might all be NTPases involved in: i) duplex unwinding during DNA and RNA replication, transcription, recombination and repair, and possibly mRNA translation; ii) DNA packaging, and iii) dNTP generation.
TL;DR: Codon bias was examined in 207 plant gene sequences collected from Genbank and the literature and the pattern of relative use of synonymous codons was shown to differ between these taxonomic groups, primarily in the use of G + C in the degenerate third base.
Abstract: We have examined codon bias in 207 plant gene sequences collected from Genbank and the literature. When this sample was further divided into 53 monocot and 154 dicot genes, the pattern of relative use of synonymous codons was shown to differ between these taxonomic groups, primarily in the use of G + C in the degenerate third base. Maize and soybean codon bias were examined separately and followed the monocot and dicot codon usage patterns respectively. Codon preference in ribulose 1,5 bisphosphate and chlorophyll a/b binding protein, two of the most abundant proteins in leaves was investigated. These highly expressed are more restricted in their codon usage than plant genes in general.
TL;DR: It is demonstrated here that human telomeres do not contain a pure uniform 6 base pair repeat unit but that there are at least three types of repeat, which are present at the ends of most or all human chromosomes.
Abstract: Using a combination of different oligonucleotides and restriction enzymes we have examined the gross organisation of repeats within the most distal region of human chromosomes. We demonstrate here that human telomeres do not contain a pure uniform 6 base pair repeat unit but that there are at least three types of repeat. These three types of repeat are present at the ends of most or all human chromosomes. The distribution of each type of repeat appears to be non-random. Each human telomere has a similar arrangement of these repeats relative to the ends of the chromosome. This could reflect differences in the functions that they perform, or might result from the mutation and correction processes occurring at human telomeres. The number of repeat units, the repeat types and arrangement differs at mouse telomeres. Analysing the change in length of the telomeric repeat region between an individuals blood and germline DNA reveals that this is due to variable amounts of the TTAGGG repeat and not the other repeat types. This organization of repeat units at human telomeres will only be confirmed upon the isolation and sequencing of full length (10-15 kb), intact human telomeres.
TL;DR: A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro and a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used.
Abstract: A procedure for the construction of general cDNA libraries is described which is based on the amplification of total cDNA in vitro. The first cDNA strand is synthesized from total RNA using an oligo(dT)-containing primer. After oligo(dG) tailing the total cDNA is amplified by PCR using two primers complementary to oligo(dA) and oligo(dG) ends of the cDNA. For insertion of the cDNA into a vector a controlled trimming of the 3' ends of the cDNA by Klenow enzyme was used. Starting from 10 J558L micron3 myeloma cells, total cDNA was synthesized and amplified approximately 10(5) fold. A library containing 10(6) clones was established from 1/6 of the amplified cDNA. Screening of the library with probes for three genes expressed in these cells revealed a number of corresponding clones in each case. The longest obtained clones contained inserts of 1.5 kb length. No sequences originating from carriers or from rRNA was found in 14 randomly picked clones.
TL;DR: It is shown that PCR can be performed directly on bacterial plaques or colonies, circumventing all DNA preparation, and allows the presence, size and orientation of Inserts to be determined rapidly by amplification with flanking primers, and (for orientation) by Including a single Internal primer.
Abstract: We show that PCR can be performed directly on bacterial plaques or colonies, circumventing all DNA preparation. This allows the presence, size and orientation of Inserts to be determined rapidly by amplification with flanking primers, and (for orientation) by Including a single Internal primer. For M13mp and pUC-based vectors, inserts of up to 3.7 kb are readily amplified using primers (A and B in upper figure) flanking the insert. The orientation of the insert may be screened using a primer (C) within the insert. The amplified material can be used directly for restriction digestion, cloning, and sequencing. Amplification reactions. 20 uJ altquots of 10mM Tris/HCI pH 8.3 at 25°C, 50mM KCI, 1.5 mM MgClj, 0.1 mg/ml gelatine, 0.25 mM dNTP, 10 pmol each oligonucleotide, 2.5 U Taq polymerase (Cetus), and template DNA were overlaid with paraffin oil, and subjected to 30 rounds of temperature cycling: 94°C 1 min, 55°C 1 min, 72°C 2 min (3 min for inserts > 2.5 kb) and a final 5 min 55°C step, on a PHC-1 programmable heating block (Techne). 5 uJ of the reaction mixture was analysed on a 1-2% agarose gel containing 1 u-g/ml EtBr. PCR on colonies. Colonies were resuspended in 0.5 ml water (live bacteria could be rescued at this stage) and boiled in a water bath for 5 minutes. After centrifugation for 2 min at 13000 rpm, 5 uJ of the supernatant was used in the PCR. PCR on plaques. Phage were transferred from a single plaque to a 20uJ PCR reaction mix using a fresh toothpick, briefly swirled in the mixture. The toothpick could then be used to innoculate bacterial cultures for preparation of sequencing template. Primers. A and B primers for M13mp and pUC were 5'-GTAAAACGACGGCCAGT and 5'-CAGGAAACAGCTATGAC, and for pSV2gpt were 5TCCAAACTCATCAATGTATC and 5'-CTCACAGTCTCCTCAGGTGAG (flanking the fiamHI cloning site in a vector containing the mouse VHNP gene). Primer C was a sequencing primer for the mouse yl genomic insert, 5'-GTGAACCCCTCCTCCCT.