Showing papers in "Mikrochimica Acta in 2015"
TL;DR: Emerging trends and future challenges such as the development of strategies for simultaneous detection of multiple targets with high spatial and temporal resolutions, the integration of microfluidic strategies for selective and localized analyte pre-concentration, the real-time monitoring of neurotransmitter secretions from active cell cultures under electro- and chemotactic cues, aptamer-based biosensors, and the miniaturization of the sensing system for detection in small sample volumes are discussed.
Abstract: Nanomaterial-modified detection systems represent a chief driver towards the adoption of electrochemical methods, since nanomaterials enable functional tunability, ability to self-assemble, and novel electrical, optical and catalytic properties that emerge at this scale. This results in tremendous gains in terms of sensitivity, selectivity and versatility. We review the electrochemical methods and mechanisms that may be applied to the detection of neurological drugs. We focus on understanding how specific nano-sized modifiers may be applied to influence the electron transfer event to result in gains in sensitivity, selectivity and versatility of the detection system. This critical review is structured on the basis of the Anatomical Therapeutic Chemical (ATC) Classification System, specifically ATC Code N (neurotransmitters). Specific sections are dedicated to the widely used electrodes based on the carbon materials, supporting electrolytes, and on electrochemical detection paradigms for neurological drugs and neurotransmitters within the groups referred to as ATC codes N01 to N07. We finally discuss emerging trends and future challenges such as the development of strategies for simultaneous detection of multiple targets with high spatial and temporal resolutions, the integration of microfluidic strategies for selective and localized analyte pre-concentration, the real-time monitoring of neurotransmitter secretions from active cell cultures under electro- and chemotactic cues, aptamer-based biosensors, and the miniaturization of the sensing system for detection in small sample volumes and for enabling cost savings due to manufacturing scale-up. The Electronic Supporting Material (ESM) includes review articles dealing with the review topic in last 40 years, as well as key properties of the analytes, viz., pKa values, half-life of drugs and their electrochemical mechanisms. The ESM also defines analytical figures of merit of the drugs and neurotransmitters. The article contains 198 references in the main manuscript and 207 references in the Electronic Supporting Material.
294 citations
TL;DR: In this paper, the authors give an overview on the progress that has been made in the past few years on the use of gold nanoparticles for use in sensors and analytical tools for the determination of dopamine (DA).
Abstract: This review (with 110 refs.) gives an overview on the progress that has been made in the past few years on the use of gold nanoparticles (AuNPs) for use in sensors and analytical tools for the determination of dopamine (DA). Both AuNPs and their composites with other organic and inorganic materials including noble metals are treated. Following an overview on the clinical significance of DA, we discuss the various analytical methods that are (a) electrochemiluminescence (ECL); (b) surface enhanced Raman scattering (SERS); (c) colorimetric probing and visual detection; and (d) the large class of electrochemical sensors. Subsections cover sensors based on plain AuNPs, bimetallic NPs, AuNP-metal@metal oxide nanocomposites, AuNP nanocomposites with organic polymers, AuNP nanocomposites with carbon nanotubes or with graphene, and finally sensors based on ternary materials containing AuNPs. The review ends with a conclusion on current challenges of sensors for DA and an outlook on future trends.
139 citations
TL;DR: In this article, a thiolated aptamer specific for AFB1 was linked to the surface of CdTe quantum dots via ligand exchange, and the fluorescence of modified-Q-dots was strongly quenched by GO.
Abstract: Aflatoxin B1 (AFB1), a secondary fungal metabolite of Aspergillus flavus, was employed as a model mycotoxin to establish an aptamer based assay that exploits the quenching of the fluorescence of CdTe quantum dots (Q-dots) by graphene oxide (GO). A thiolated aptamer specific for AFB1 was linked to the surface of Q-dots via ligand exchange. The fluorescence of the aptamer modified-Q-dots is strongly quenched by GO. If, however, AFB1 is added, fluorescence is restored depending on the quantity of AFB1 added. The system was evaluated both in phosphate buffer solution and in peanut oil. If performed in an aqueous system, the assay possesses good selectivity, a wide dynamic range (from 3.2 nM to 320 μM) and a low limit of detection (1.0 nM). If performed in peanut oil solution, the dynamic range is from 1.6 nM to 160 μM, and the limit of detection is 1.4 nM. In our perception, this is a simple, sensitive and selective method for the determination of AFB1 that also may be extended to the analysis of other mycotoxins.
134 citations
TL;DR: In this paper, a method for simultaneous detection of the pathogens Vibrio parahaemolyticus and Salmonella typhimurium using dual fluorescence resonance energy transfer (FRET) was proposed.
Abstract: We report on a method for simultaneous detection of the pathogens Vibrio parahaemolyticus and Salmonella typhimurium. It is based on dual fluorescence resonance energy transfer (FRET) from green-emitting quantum-dots (gQDs) and red-emitting quantum-dots (rQDs) as donors, and on novel amorphous carbon nanoparticles (CNPs) that act as acceptor. The gQDs were modified with an aptamer (Apt 1) recognizing V. parahaemolyticus, and the rQDs with an aptamer (Apt 2) recognizing S. typhimurium. The fluorescence of both QDs is strongly quenched in the presence of CNPs. However, on addition of the target analytes, the QDs-aptamer-target complex is formed and quenching by CNPs is suppressed. The fluorescence of the QDs is linearly proportional to the concentration of the two pathogens in the range from 50 to 106 cfu·mL−1, with detection limits as low as 25 cfu·mL−1 for V. parahaemolyticus, and of 35 cfu·mL−1 for S. typhimurium. The assay was applied to real food samples, and the results were consistent with the results obtained with plate counting methods. We presume that this strategy can be extended to the detection of other pathogenic bacteria and biomolecules by simply substituting the aptamer.
121 citations
TL;DR: In this article, the authors reported that GQDs are viable fluorescent probes for the determination of chromium(VI) and ascorbic acid in an on-off-on mode.
Abstract: We report that graphene quantum dots (GQDs) are viable fluorescent probes for the determination of chromium(VI) and ascorbic acid in an on-off-on mode. The fluorescence of GQDs is strongly quenched by Cr(VI) mainly due to an inner filter effect and static quenching. This shifts the system to the “off” status. The quenching mechanism of this fluorescent system was investigated in some detail. Fluorescence intensity is inversely proportional to the concentration of Cr(VI) in the 0.05 to 500 μM concentration range with a 3.7 nM detection limit. The fluorescence of GQDs-Cr(VI) system is converted back to “on” by adding ascorbic acid which will reduce yellow Cr(VI) ion, thereby eliminating the inner filter effect and static quenching. The relative intensity of restored fluorescence is directly proportional to the concentration of ascorbic acid in the 1.0 to 500 μM range, and the limit of detection is 0.51 μM. There are almost no interferences to commonly encountered other substances. The methods were applied to the determination of Cr(VI) in spiked tape, lake and river waters, and of ascorbic acid in a tablet and human urine. Both gave satisfactory results.
118 citations
TL;DR: In this article, the chemiluminescence (CL) reaction with hypochlorite was studied and the effect of radical scavengers on the reaction was studied, and the method was successfully applied to the determination of free chlorine in (spiked) samples of tap water and pool water.
Abstract: Graphene quantum dots (GQDs) were prepared by a new and facile procedure, and their chemiluminescence (CL) reaction with hypochlorite was studied. It was found that hypochlorite can directly oxidize GQDs to give rise to CL emission, and that the surfactant cetyl trimethyl ammonium bromide enhances CL by a factor of about 18. CL and fluorescence spectra were acquired, and the effect of radical scavengers on the reaction was studied. This CL system was used to develop a simple and sensitive method for the determination of hypochlorite in the 0.5 μM to 1.0 mM concentration range, with a detection limit of 0.3 μM. The method was successfully applied to the determination of free chlorine in (spiked) samples of tap water and pool water.
108 citations
TL;DR: In this article, a single-step thermolysis strategy was used to prepare highly luminescent nitrogen-doped and amino acid-functionalized graphene quantum dots (NA-GQDs) by using glycine as both carbon and nitrogen source.
Abstract: We report on a single-step thermolysis strategy to prepare highly luminescent nitrogen-doped and amino acid-functionalized graphene quantum dots (NA-GQDs) by using glycine as both carbon and nitrogen source. The NA-GQDs display an excitation wavelength-dependent fluorescence with maximum excitation and emission wavelengths of 380 and 450 nm, respectively, and a quantum yield of ~16 %. Fluorescence is quenched by Fe(III) and Hg(II), and the effect was used to develop a method for the determination of Fe(III). Quenching by Fe(III) is attributed to its higher thermodynamic affinity (compared to other transition-metal ions) for the ligands on the GQDs in which nitrogen atoms mainly act as the chelating atoms. A linear relationship was observed between fluorescence intensity and the concentration of Fe(III) over the 0.5 μM to 0.5 mM range. The detection limit is 0.1 μM.
107 citations
TL;DR: In this paper, a photoelectrochemical (PEC) sensor was constructed by using amino-MIL-125/TiO2 (MIL stands for Materials from Institute Lavoisier), an amino-functionalized metal-organic framework (MOF) modified with TiO2.
Abstract: We describe a sensitive photoelectrochemical (PEC) sensor for the determination of the herbicide clethodim. The PEC sensor was constructed by using amino-MIL-125/TiO2 (MIL stands for Materials from Institute Lavoisier), an amino-functionalized metal-organic framework (MOF) modified with TiO2. The amino-MIL-125/TiO2 was synthesized by a simple one-step solvothermal method and placed on a glassy carbon electrode where it displays photoelectrocatalytic activity. Scanning electron microscopy (SEM), Fourier-transform infrared (FTIR) spectroscopy and X-ray diffractometry (XRD) were used to characterize the amino-MIL-125/TiO2. In the sensing process, amino-MIL-125/TiO2 is illuminated by visible light to produce electrons. These excited electrons are delivered to the glassy carbon electrode, leaving positively charged holes (h+) on the surface of the amino-MIL-125/TiO2. The holes react with H2O to generate hydroxy radicals (•OH). Clethodim rapidly attacks the hydroxy radicals and improves the efficiency of charge separation, this leading to an enhanced photocurrent. Under the optimal experimental conditions, this photoelectrochemical method enables clethodim to be quantified in the concentration range from 0.2 to 25 μmol L−1, with a detection limit (3 S/N) of 10 nmol L−1. The assay was applied to the determination of clethodim in soil samples, and results were in acceptable agreement with data obtained by liquid chromatography/mass spectrometry.
93 citations
TL;DR: Hydroxyapatite nanoparticles with different functional properties such as luminescence and magnetism are potential candidates for drug delivery as well as multimodal imaging.
Abstract: Hydroxyapatite (HAp) is the most important constituent of biological tissues such as bone and teeth and exhibits several characteristic features. HAp nanoparticles (NPs) are good host materials and can be functionalized with various kinds of dopants and substrates. By endowing HAp NPs with desired properties in order to render them suitable for biomedical applications including cellular imaging, non-invasive and quantitative visualisation of molecular process occurring at cellular and subcellular levels becomes possible. Depending on their functional properties, HAp based nanoprobes can be divided into three classes, i.e., luminescent HAp NPs (for both downconversion and upconversion luminescence), magnetic HAp NPs, and luminomagnetic HAp NPs. Luminomagnetic HAp NPs are particularly attractive in terms of bimodal imaging and even multimodal imaging by virtue of their luminescence and magnetism. Functionalised HAp NPs are potential candidates for targeted drug delivery applications. This review (with 166 references) spotlights the cellular imaging applications of three types of HAp NPs. Specific sections cover aspects of molecular imaging and the various imaging modes, a comparison of the common types of nanoprobes for bioimaging, synthetic methods for making the various kinds of HAp NPs, followed by overviews on fluorescent NPs for bioimaging (such as quantum dots, gold nanoclusters, lanthanide-doped or fluorophore-doped NPs), magnetic HAp NPs for use in magnetic resonance imaging (MRI), luminomagnetic HAp NPs for bimodal imaging, and sections on drug delivery as well as cellular imaging applications of HAp based nanoprobes (including targeted imaging).
92 citations
TL;DR: A cytotoxicity study showed carbon dots to be cell permeable and biocompatible which renders them appropriate for imaging applications, and well suitable for bio-imaging of HeLa cells.
Abstract: A jelly-like form of carbon dots (C-dots) was prepared by microwave-assisted synthesis from citric acid in the presence of tetraoctylammonium bromide. The effect of the concentration of tetraoctylammonium bromide was examined. The synthesized carbon dots were characterized by UV–vis, XRD, FTIR, fluorescence and HR-TEM. Fluorescence extends from 350 to 600 nm, and the corresponding excitation wavelengths range from 300 to 460 nm. Quantum yields are at around 0.11. A cytotoxicity study showed carbon dots to be cell permeable and biocompatible which renders them appropriate for imaging applications. The dots were used to image HeLa cell lines via the blue fluorescence of the dots.
91 citations
TL;DR: The state of the art in molecularly imprinting technology as applied to the surface of carbon nanotubes (CNTs) which result in so-called CNTs@MIPs is summarized in this paper.
Abstract: This review (with 142 references) summarize the state of the art in molecularly imprinting technology as applied to the surface of carbon nanotubes (CNTs) which result in so-called CNTs@MIPs. These nanomaterials offer a remedy to the flaws of traditional MIPs, such as poor site accessibility for templates, slow mass transfer and template leakage. They also are flexible in that different materials can be integrated with CNTs. Given the advantages of using CNT@MIPs, this technology has experienced rapid expansion, not the least because CNT@MIPs can be produced at low cost and by a variety of synthetic approaches. We summarize methods of, and recent advances in the synthesis of CNT@MIPs, and then highlight some representative applications. We also comment on their potential future developments and research directions.
TL;DR: In this article, a screen-printed electrochemical electrode for paraoxon based on its inhibitory effect on the enzyme butyrylcholinesterase (BChE) was developed.
Abstract: We have developed a screen-printed electrochemical electrode (SPE) for paraoxon based on its inhibitory effect on the enzyme butyrylcholinesterase (BChE). The electrode was first modified by drop casting with a dispersion of carbon black nanoparticles (CBNPs) in a dimethylformamide-water mixture, and BChE was then immobilized on the surface by cross-linking. The resulting biosensor was exposed to standard solutions of paraoxon, and the enzymatic hydrolysis of butyrylthiocholine over time was determined measuring the enzymatic product thiocholine at a working voltage of +300 mV. The enzyme inhibition is linearly related to the concentration of paraoxon up to 30 μg L−1, and the detection limit is 5 μg L−1. The biosensor is stable for up to 78 days of storage at room temperature under dry conditions. It was applied to determined paraoxon in spiked waste water samples. The results underpin the potential of the use of CBNPs in electrochemical biosensors and also demonstrate that they represent a viable alternative to other carbon nanomaterials such as carbon nanotubes or graphene, and with the advantage of being very affordable.
TL;DR: In this paper, the synthesis of carbon dots (C-dots) by thermal carbonization of a mixture of ethyleneglycol bis-(2-aminoethyl ether)-N,N, N’,N’-tetraacetic acid (EGTA) and tris(hydroxymethyl)aminomethane (Tris) was reported.
Abstract: We report on the synthesis of carbon dots (C-dots) by thermal carbonization of a mixture of ethyleneglycol bis-(2-aminoethyl ether)-N,N,N’,N’-tetraacetic acid (EGTA) and tris(hydroxymethyl)aminomethane (Tris). The resulting C-dots were characterized by X-ray diffraction, proton and carbon nuclear magnetic resonance, FTIR and fluorescence spectroscopy, and high-resolution TEM. The data reveal that the C-dots are mainly capped with hydroxy and carbonyl groups and are highly fluorescent with an emission peak that shifts from 427 to 438 nm if the excitation wavelength is increased from 310 to 360–370 nm. Fluorescence is quenched by 4-nitrophenol (4-NP), and this effect was exploited to design a simple and rapid protocol for the determination of 4-NP. The detection limit is 28 nM and the linear range extends from 0.1 to 50 μM. The method was successfully applied to the determination of 4-NP in spiked river and sea waters.
Abstract: A facile, one-pot green method is presented for the preparation of water-soluble luminescent copper nanoclusters (Cu-NCs) from copper dichloride and cysteine as the precursor and stabilizer, respectively. The Cu-NCs are characterized by high resolution transmission electron microscopy, X-ray photoelectron spectroscopy, fluorescence, UV–Vis, and Raman spectroscopy. The Cu-NCs have an average size of 3.5 nm and are stable in aqueous solution at least for 2 weeks. Under photo excitation with 365 nm light, the Cu-NCs display strong green fluorescence with the maximum of emission at 490 nm and a quantum yield of 5.6 %. Fluorescence is quenched by Cr(VI) ion, and this effect was exploited to develop a highly selective method for the determination of Cr(VI). The detection limit of this probe is as low as 43 nM.
TL;DR: In this article, a nanomaterial of the chemical composition Cu2(OH)3Cl-CeO2 and with a large surface area is shown to be a viable peroxidase mimetic, which was synthesized by co-precipitation of an aqueous solution containing Ce(III) chloride, Cu(II) chloride and hexamethylenetetramine by adding an ionic liquid.
Abstract: A nanomaterial of the chemical composition Cu2(OH)3Cl-CeO2 and with a large surface area is shown to be a viable peroxidase mimetic. It was synthesized by co-precipitation of an aqueous solution containing Ce(III) chloride, Cu(II) chloride and hexamethylenetetramine by adding an ionic liquid. The material was characterized by scanning electron microscopy and X-ray powder diffractometry. The composite possesses peroxidase-like activity and catalyzes the oxidation of the peroxidase substrate 3,3′,5,5′-tetramethylbenzidine by H2O2 to produce a blue product. Based on this finding, a simple, rapid and selective colorimetric method was worked out for the determination of glucose and cholesterol by using the respective oxidases and by quantifying the H2O2 formed. Both glucose and cholesterol can be determined by this method at levels as low as 50 µM.
TL;DR: In this article, a nanocomposite consisting of flower-like zinc oxide (ZnO) and reduced functionalized graphene oxide (rFGO) was prepared via a hydrothermal route, and characterized by spectrophotometry, photoluminescence, Raman spectroscopy, X-ray diffraction, scanning electron microscopy, and transmission electron microscope.
Abstract: A nanocomposite consisting of flower-like zinc oxide (ZnO) and reduced functionalized graphene oxide (rFGO) was prepared via a hydrothermal route, and characterized by spectrophotometry, photoluminescence, Raman spectroscopy, X-ray diffraction, scanning electron microscopy, and transmission electron microscopy. The nanocomposite was deposited on the surface of a glassy carbon electrode and studied using impedance spectroscopy. It exhibits excellent electrocatalytic activity toward the oxidation of nitrite. At a working potential of 0.9 V (vs. Ag/AgCl), it displayed a higher current and lower over potential (reduced by up to ~200 mV) than controlled electrodes. This is attributed to the synergistic catalytic effects of the ZnO and rfGO. The oxidation current is linearly related to the concentration of nitrite in the 10 μM to 8 mM range, and the detection limit is 33 μM. Its excellent electrocatalytic activity, wide linear range, low detection limit, high sensitivity, and rapid response time make this nanocomposite-based electrode a potential candidate for practical applications.
TL;DR: In this paper, Mn(II)-doped ZnS quantum dots with an acrylamide-based molecularly imprinted polymer (MIP-coated QDs) were used as a fluorescent probe for the selective and sensitive detection of the insecticide chlorpyrifos (CPF).
Abstract: We show that Mn(II)-doped ZnS quantum dots coated with an acrylamide-based molecularly imprinted polymer (MIP-coated QDs) can act as a fluorescent probe for the selective and sensitive detection of the insecticide chlorpyrifos (CPF). The fluorescence of the coated QDs is quenched on loading the MIP with CPF, and the effect is much stronger for the MIP than for the non-imprinted polymer. The MIP-coated QDs were characterized by fluorescence spectrophotometry, X-ray powder diffraction, and scanning electron microscopy. Under optimal conditions, the relative fluorescence intensity of the MIP-coated QDs decreases linearly with the increasing concentration of CPF in the 0.3–60 μmol L−1 concentration range, and the detection limit is 17 nmol L−1. The method has been used for the determination of CPF in spiked water samples and gave recoveries in the range from 87.1 to 94.5 % with relative standard deviations in the 2.9 to 6.5 % range. The method is simple, safe and inexpensive.
TL;DR: In this paper, an indirect optical method for the determination of glucose via the detection of hydrogen peroxide (H2O2) that is generated during the glucose oxidase (GOx) catalyzed oxidation of glucose.
Abstract: We report on an indirect optical method for the determination of glucose via the detection of hydrogen peroxide (H2O2) that is generated during the glucose oxidase (GOx) catalyzed oxidation of glucose. It is based on the finding that the ultraviolet (~374 nm) and visible (~525 nm) photoluminescence of pristine zinc oxide (ZnO) nanoparticles strongly depends on the concentration of H2O2 in water solution. Photoluminescence is quenched by up to 90 % at a 100 mM level of H2O2. The sensor constructed by immobilizing GOx on ZnO nanoparticles enabled glucose to be continuously monitored in the 10 mM to 130 mM concentration range, and the limit of detection is 10 mM. This enzymatic sensing scheme is supposed to be applicable to monitoring glucose in the food, beverage and fermentation industries. It has a wide scope in that it may be extended to numerous other substrate or enzyme activity assays based on the formation of H2O2, and of assays based on the consumption of H2O2 by peroxidases.
TL;DR: The use of biofunctionalized Noble Metal nanoparticles (NM-NPs) often results in amplified recognition via stronger loading of signal tags, and also in enhanced signal.
Abstract: Electrochemical immunodetection has attracted considerable attention due to its high sensitivity, low cost and simplicity. Large efforts have recently made in order to design ultrasensitive assays. Noble metal nanoparticles (NM-NPs) offer advantages such as high conductivity and large surface-to-volume ratio. NM-NPs therefore are excellent candidates for developing electrochemical platforms for immunodetection and as signal tags. The use of biofunctionalized NM-NPs often results in amplified recognition via stronger loading of signal tags, and also in enhanced signal. This review (with 87 references) gives an overview on the current state in the use of NM-NPs in Non-enzymatic electrochemical immunosensing. We discuss the application of NM-NPs as electrode matrices and as electroactive labels (either as a carrier or as electrocatalytic labels), and compare the materials (mainly nanoparticles of gold, platinum, or of bimetallic materials) in terms of performance (for example by increasing sensitivity via label amplification or via high densities of capture molecules). A conclusion covers current challenges and gives an outlook. Rather than being exhaustive, the review focuses on representative examples that illustrate novel concepts and promising applications. NM-NPs based immunosensing opens a series of concepts for basic research and offers new tools for determination of trace amounts of protein-related analytes in environment and clinical applications.
TL;DR: In this article, a probe for the colorimetric and bare-eye detection of dopamine (DA) is presented, based on the finding that DA inhibits the melamine-induced aggregation of red gold nanoparticles (AuNPs) to form blue AuNP clusters.
Abstract: We report on a probe for the colorimetric and bare-eye detection of dopamine (DA). The optical effect is based on the finding that DA inhibits the melamine-induced aggregation of red gold nanoparticles (AuNPs) to form blue AuNP clusters. We presume that the aggregation induced by melamine is due to its strong hydrogen-bonding interactions with DA. The color changes can be monitored by spectrophotometry or the bare eye. The probes works over the 33 nM to 3.33 mM DA concentration range, and levels down to 33 nM can be quantified. The nanoprobe was successfully applied to the determination of DA in spiked serum.
TL;DR: In this article, the preparation of nanoporous carbon using a metal-organic framework (MOF) as a template and furfuryl alcohol as the source for carbon was described.
Abstract: We describe the preparation of nanoporous carbon using a metal-organic framework (MOF) as a template and furfuryl alcohol as the source for carbon. The MOF consists of a zeolitic framework (ZIF-8) that was obtained from 2-methylimidazole and Zn(II) ions. ZIF-8 was soaked with furfuryl alcohol which then was carbonized at 900 °C. The resulting nanoporous carbon (MOF-C) exhibits a high specific surface area and a large pore volume. It was used as a dispersive solid-phase adsorbent for the preconcentration of the benzoylurea insecticides diflubenzuron, triflumuron, hexaflumuron and teflubenzuron from water and tangerine samples. Under optimized conditions, the methods exhibits excellent extraction performance. The insecticides can be quantified via HPLC with UV detection in the 0.5 to 100 ng mL−1 concentration range in case of spiked tap water, and in the 2.0 to 200 ng g−1 concentration range in case of tangerines. The limits of detection range from 0.10 to 0.23 ng mL−1 in case of water samples, and from 0.34 to 0.71 ng g−1 for tangerine sample (at an S/N ratio of 3). Mean recoveries range from 91.7 to 107.9 %, with relative standard deviations of <7.1 %. The results indicate that the method was efficient for the preconcentration of trace levels of benzoylurea insecticides from water and tangerine samples. Conceivably, this new adsorbent has a large potential with respect to the enrichment of other organic pollutants from various kinds of samples.
TL;DR: In this paper, a method for the simultaneous detection of oxytetracycline (OTC) and kanamycin (KMY) using aptamers acting as both recognition and separation elements, and complementary oligonucleotides labeled with a green emitting fluorophore (carboxyfluorescein, FAM) and a yellow emitting fluorescence (CARBOXy-X-rhodamine, ROX), respectively, as signal labels, was described.
Abstract: This work describes a method for the simultaneous detection of oxytetracycline (OTC) and kanamycin (KMY) using aptamers acting as both recognition and separation elements, and complementary oligonucleotides labeled with a green emitting fluorophore (carboxyfluorescein, FAM) and a yellow emitting fluorophore (carboxy-X-rhodamine, ROX), respectively, as signal labels An OTC aptamer and a KMY aptamer were immobilized on the surface of magnetic nanoparticles (MNPs) via avidin-biotin chemistry The aptamers preferentially bind their respective targets and thereby cause the upconcentration of analytes However, in their absence they bind fluorescently-tagged complementary oligonucleotide later added to the reaction system This cause the NPs to become fluorescent, with emission peaks located at 520 and 608 nm, respectively The effects of the concentration of avidin, aptamer, complementary oligonucleotide, incubation temperature and incubation time were optimized Under the optimal conditions, linear relationships were obtained in the range of 1–50 ng∙mL−1 for OTC and KMY, with limits of detection of 085 ng∙mL−1 and 092 ng∙mL−1, respectively The method was applied to the analysis of pork, milk, and honey samples spiked with OTC and MKY Recoveries ranged from 765 to 947 % and 778 to 931 %, respectively, and the relative standard deviation was <100 %
TL;DR: This assay is sensitive, highly specific, acceptably accurate and reproducible, and represents a promising tool for the detection of S. pullorum, S. gallinarum, and - conceivably - of other food-borne pathogens by exchanging the antibody.
Abstract: This article describes an electrochemical immunosensor for rapid determination of Salmonella pullorum and Salmonella gallinarum. The first step in the preparation of the immunosensor involves the electrodeposition of gold nanoparticles used for capturing antibody and enhancing signals. In order to generate a benign microenvironment for the antibody, the ionic liquid (IL) 1-butyl-3-methylimidazolium hexafluorophosphate was used to modify the surface of a screen-printed carbon electrode (SPCE). The single steps of modification were monitored via cyclic voltammetry and electrochemical impedance spectroscopy. Based on these findings, a sandwich immunoassay was worked out for the two Salmonella species by immobilizing the respective unlabeled antibodies on the SPCE. Following exposure to the analytes, secondary antibody (labeled with HRP) is added to form the sandwich. After adding hydrogen peroxide and thionine, the latter is oxidized and its signal measured via CV. A linear response to the Salmonella species is obtained in the 104 to 109 cfu · mL−1 concentration range, and the detection limits are 3.0 × 103 cfu · mL−1 for both species (at an SNR of 3). This assay is sensitive, highly specific, acceptably accurate and reproducible. Given its low detection limit, it represents a promising tool for the detection of S. pullorum, S. gallinarum, and - conceivably - of other food-borne pathogens by exchanging the antibody.
TL;DR: In this article, a highly sensitive electrochemical biosensor was fabricated by immobilizing hemoglobin (Hb) onto the surface of a glassy carbon electrode (GCE) modified with a nanocomposite made from polypyrrole@poly (styrene-alt-maleic anhydride) grafted with 4-aminobenzenesulfonate.
Abstract: We reported on a highly sensitive electrochemical biosensor that was fabricated by immobilizing hemoglobin (Hb) onto the surface of a glassy carbon electrode (GCE) modified with a nanocomposite made from polypyrrole@poly (styrene-alt-maleic anhydride) grafted with 4-aminobenzenesulfonate. Cyclic voltammograms of the modified GCE at pH 7 exhibited a pair of well-defined redox peaks, thus attesting the direct electron transfer from Hb to the electrode. The biosensor can be used to determine H2O2 and, if operated at a working voltage of −0.4 V, displays a linear response to H2O2 in the 0.8 μM to 460 μM concentration range, and a lower detection limit of 0.32 μM. The surface coverage of active Hb, heterogeneous electron transfer rate constant (ks) and Michaelis-Menten constant (Km) of immobilized Hb are, respectively, 1.52 × 10−9 mol cm−2, 1.3 s−1, and 0.45 mM. Additional features of this biosensor include stability, simplicity, and fast preparation at low-costs. It was successfully applied to the determination of hydrogen peroxide in rainwater samples where it displayed good accuracy and precision.
TL;DR: In this paper, a glassy carbon electrode (GCE) was modified with a hybrid material consisting of multiwalled carbon nanotubes (CNT) and molybdenum disulfide (MoS2).
Abstract: We report on a non-enzymatic electrochemical sensing strategy for ultrasensitive detection of hydrogen peroxide (H2O2) at nanomolar levels. A glassy carbon electrode (GCE) was modified with a hybrid material consisting of multiwalled carbon nanotubes (CNT) and molybdenum disulfide (MoS2). Transmission electron microscopy and Raman spectroscopy were employed to characterize the hybrid nanostructures. GCEs modified with carbon nanotubes, or nanoscaled MoS2, or with the CNT-MoS2 hybrid were investigated with respect to sensing H2O2, and this revealed that the GCE modified with the CNT-MoS2 hybrid performed best and resulted in a limit of detection as low as 5.0 nM. A repeatability and intermediate precision of 9 % was accomplished. The method was applied to determine H2O2 in spiked sterilized milk and gave satisfactory results.
TL;DR: In this article, the synthesis and characterization of highly fluorescent gold nanoclusters (Au-NCs) from a gold precursor using a single-step chemical reduction in the presence of human adult hemoglobin (Hb).
Abstract: We report on the synthesis and characterization of highly fluorescent gold nanoclusters (Au-NCs) from a gold precursor using a single-step chemical reduction in the presence of human adult hemoglobin (Hb). The conformational changes of Hb before and after cluster formation were studied by various spectroscopic techniques. The Au-NCs in Hb display blue fluorescence with a peak centered at 450 nm (photoexcited at 365 nm) and a quantum yield of 2.8 %. The Au-NCs exhibit excellent photostability and long-term stability, and can be applied in the pH range 5–12 even in the presence of high electrolyte concentrations. The Au-NCs in Hb can act as a highly sensitive and selective fluorescent turn-off probe for Cu(II) ion. The observed reversible fluorescence recovery of Hb-AuNCs/Cu(II) aggregates was exploited to develop a selective and sensitive turn-on fluorescence assay for His. Under optimized conditions, the probe gives a fluorescent response that is linear in the 0.1 to 20.0 μM concentration range of Cu(II), with a limit of detection of 28 nM. The probe for His, in turn, has a linear range in the 1–21 μM concentration range, and the limit of detection is 0.6 μM.
TL;DR: Porous gold nanosheets modified glassy carbon electrode (GCE) was facilely prepared by one-step electrodeposition, using N-methylimidazole as a growth-directing agent.
Abstract: Porous gold nanosheets modified glassy carbon electrode (GCE) was facilely prepared by one-step electrodeposition, using N-methylimidazole as a growth-directing agent. The porous gold nanosheets modified GCE was characterized by scanning electron microscopy, transmission electron microscopy, and X-ray diffraction spectroscopy. The modified electrode displayed improved sensitivity for individual and simultaneous differential pulse voltammetric determination of dopamine (DA; at 180 mV) and acetaminophen (AC; at 450 mV vs. Ag/AgCl) even in the presence of ascorbic acid. The oxidation peak currents linearly increased with the concentrations of DA and AC in the ranges from 2.0 to 298.0 μM and 3.0 to 320.0 μM, respectively, and the detection limits are 0.28 μM for DA and 0.23 μM for AC. The relative standard deviations (n = 20) are 1.5 % for DA and 0.4 % for AC.
TL;DR: In this paper, an aptasensor for the determination of dopamine in human serum and with ultrahigh sensitivity and selectivity is described. The sensor is based on a nanocomposite consisting of reduced graphene oxide (rGO) and the conducting polymer poly(3,4-ethylenedioxythiophene) (PEDOT), which was prepared by electrochemical polymerization of EDOT using graphene oxide as the dopant which was later electrochemically reduced to form rGO.
Abstract: We describe an aptasensor for the determination of dopamine in human serum and with ultrahigh sensitivity and selectivity. The sensor is based on a nanocomposite consisting of reduced graphene oxide (rGO) and the conducting polymer poly(3,4-ethylenedioxythiophene) (PEDOT). The PEDOT/rGO interface was prepared by electrochemical polymerization of EDOT using graphene oxide as the dopant which is later electrochemically reduced to form rGO. Subsequent covalent modification of the high surface area composite with a selective aptamer enables highly sensitive and selective detection by differential pulse voltammetry. The calibration plot established at a working voltage of 160 mV displays a linear response in the 1 pM to 160 nM concentration range and an unprecedented detection limit of 78 fM. The sensor is fairly selective in not responding to common interferents, and is reusable after regeneration with a 7 M solution of urea. It was successfully applied to (spiked) serum samples and gave recoveries ranging from 98.3 to 100.7 %.
TL;DR: In this article, an electrochemical immunoassay is described for the detection of the protein biomarker mucin 1 and of breast cancer cells of type MCF-7 where MUC-1 is overexpressed.
Abstract: An electrochemical immunoassay is described for the detection of the protein biomarker mucin 1 (MUC-1) and of breast cancer cells of type MCF-7 where MUC-1 is overexpressed. The method is based on the use of silver nanoclusters (Ag-NCs) acting as a signalling probe. The Ag-NCs were synthesized via chemical reduction in the presence of a DNA strand with the sequence of 5′-GCAGTTGATCCTTTGGATACCCTGG-C12-3′. The strand contains mucin 1 aptamer (GCAGTTGATCCTTTGGATACCCTGG) that can specifically bind to MUC1 and the template (C12) for synthesis of Ag-NCs. The assay involves the following steps: (1) Construction of an immunosensor by immobilizing the antibody against MUC-1 on a glassy carbon electrode; (2) addition of sample containing MUC-1; (3) addition of Ag-NCs; (4) signal amplification via silver enhancement process (deposition of metal silver on Ag-NCs); (5) measurement via square wave voltammetry. The current measured at a potential of 0.11 V (vs. SCE) is logarithmically related to the concentration of MUC-1 in the 1 to 500 nM range, with a detection limit of 0.5 nM. We also demonstrate that MCF-7 cancer cells can be detected by this method with high sensitivity (50 cells per mL) due to the presence of MUC-1 proteins on the cell surface.
TL;DR: In this article, a selective and sensitive method for determination of creatinine using citrate-stabilized gold nanoparticles (AuNPs) as a colorimetric probe was demonstrated.
Abstract: We demonstrate a selective and sensitive method for determination of creatinine using citrate-stabilized gold nanoparticles (AuNPs) as a colorimetric probe. It is based on a direct cross-linking reaction that occurs between creatinine and AuNPs that causes aggregation of AuNPs and results in a color change from wine red to blue. The absorption peak is shifted from 520 to 670 nm. Under the optimized conditions, the shift in the absorption peak is related the logarithm of the creatinine concentration in the 0.1 to 20 mM range, and the instrumental detection limit (LOD) is 80 μM. This LOD is about one order of magnitude better than that that of the Jaffe method (720 μM). The assay displays good selectivity over interfering substances including various inorganic ions, organic small compounds, proteins, and biothiols. It was successfully employed to the determination of creatinine in spiked human urine.