Publisher’s version / Version de l'éditeur:
Journal of Allergy Clinical Immunology, 114, July 1, pp. 174-182, 2004
READ THESE TERMS AND CONDITIONS CAREFULLY BEFORE USING THIS WEBSITE.
https://nrc-publications.canada.ca/eng/copyright
Vous avez des questions?
Nous pouvons vous aider. Pour communiquer directement avec un auteur, consultez la
première page de la revue dans laquelle son article a été publié afin de trouver ses coordonnées. Si vous n’arrivez
pas à les repérer, communiquez avec nous à PublicationsArchive-ArchivesPublications@nrc-cnrc.gc.ca.
Questions? Contact the NRC Publications Archive team at
PublicationsArchive-ArchivesPublications@nrc-cnrc.gc.ca. If you wish to email the authors directly, please see the
first page of the publication for their contact information.
NRC Publications Archive
Archives des publications du CNRC
This publication could be one of several versions: author’s original, accepted manuscript or the publisher’s version. /
La version de cette publication peut être l’une des suivantes : la version prépublication de l’auteur, la version
acceptée du manuscrit ou la version de l’éditeur.
For the publisher’s version, please access the DOI link below./ Pour consulter la version de l’éditeur, utilisez le lien
DOI ci-dessous.
https://doi.org/10.1016/j.jaci.2004.03.049
Access and use of this website and the material on it are subject to the Terms and Conditions set forth at
Activation of mast cells by double-stranded RNA: evidence for
activation through toll-like receptor 3 (TLR3)
Kulka, Marianna; Alexopoulou, Lena; Flavell, Richard A.; Metcalfe, Dean D.
https://publications-cnrc.canada.ca/fra/droits
L’accès à ce site Web et l’utilisation de son contenu sont assujettis aux conditions présentées dans le site
LISEZ CES CONDITIONS ATTENTIVEMENT AVANT D’UTILISER CE SITE WEB.
NRC Publications Record / Notice d'Archives des publications de CNRC:
https://nrc-publications.canada.ca/eng/view/object/?id=9b35954e-373c-44fa-a417-0a518dac51d5
https://publications-cnrc.canada.ca/fra/voir/objet/?id=9b35954e-373c-44fa-a417-0a518dac51d5
Activation of mast cells by double-stranded
RNA: Evidence for activation through Toll-like
receptor 3
Marianna Kulka, PhD,
a
Lena Alexopoulou, PhD,
b
Richard A. Flavell, PhD,
c
and
Dean D. Metcalfe, MD
a
Bethesda, Md, Marseille, France, and New Haven, Conn
Background: Although mast cells (MCs) have been clearly
implicated in innate immune responses involving bacteria, their
ability to respond to viral infection is less clear.
Objective: Given that MCs increase at sites of inflammation
and are located at surfaces where exposure to invading viruses
may occur, we explored the ability of MCs to produce cytokines
including type I IFNs after exposure to viruses and to
polyinosine-polycytidylic acid (polyI:C), a synthetic mimic of
viral double-stranded RNA, and characterized the receptors
involved, if any.
Methods: Human peripheral blood-derived cultured MCs and
2 MC lines, Laboratory of Allergic Disease MC line and human
MC line 1, were stimulated with viruses and polyI:C, and
cytokine production, degranulation, and signaling pathway
activation were examined. Because polyI:C is a ligand for Toll-
like receptor (TLR)e3, human MCs were also analyzed for
TLR expression.
Results: Viruses and polyI:C induced IFN-a and IFN-b
production. PolyI:C did not induce TNF, IL-1b, IL-5, or GM-
CSF production, in contrast with other TLR ligands (LPS,
peptidoglycan, CpG-A, or flagellin). IFN-a production involved
nuclear factorekB, p38, and C-Jun NH2-terminal kinase and
mitogen-activated protein kinase. RT-PCR and Western blot
analysis confirmed expression of TLR-3 by all MCs. Human
cultured MCs also expressed TLR-1, TLR-2, TLR-4, TLR-5,
TLR-6, TLR-7 and TLR-9. Antibodies to TLR-3 significantly
decreased IFN-a production. Bone marrowederived MCs from
TLR-3 knockout mice showed an ablated response to polyI:C.
Conclusions: Murine and human MCs produce type I IFNs
after exposure to double-stranded RNA and/or virus, the
former via specific interactions with TLR-3. These data suggest
that MCs contribute to innate immune responses to viral
infection via the production of type I IFNs. (J Allergy Clin
Immunol 2004;114:174-82.)
Key words: Mast cells, human, Toll-like receptors, innate immunity,
type I interferons, double-stranded RNA, viruses
Mast cells (MCs) are long-lived CD34
+
-derived cells
that migrate to sites of inflammation and regulate innate
immune responses via production of cytokines,
leukotrienes, and other inflammatory mediators.
1
Indeed,
MCs of human and rodent origin have been shown to
express Toll-like receptor (TLR)e1, TLR-2, TLR-4, and
TLR-6 mRNA and to respond to lipopolysaccharide and
peptidoglycan by producing TNF-a, GM-CSF, IL-1b, IL-
5, IL-13, and leukotriene C
4
.
2,3
Although these studies
suggest that MCs contribute to innate immune responses
against invading bacteria, little is known regarding the
interaction of MCs with viruses or their products, and
whether this interaction results in the production of innate
cytokines like type I IFNs, known to play critical roles in
host defense against viral infection via both virocidal and
immunoregulatory properties.
To address this possibility, we examined the ability of
human MC lines, as well as primary cultures of human
CD34
+
cellederived MCs, to respond to both viruses and
polyinosine-polycytidylic acid (polyI:C), a synthetic
mimic of viral double-stranded RNA (dsRNA) that is
thought to be an important viral pathogen-associated
molecular pattern. We show that MCs produced type I
IFNs after exposure to polyI:C, respiratory syncytial virus,
influenza virus, and type 1 reovirus, and expressed TLR-3
as well as all other known TLRs except TLR-10. In
addition, TLR-3 signaling with polyI:C was uniquely
capable of inducing the production of type I IFNs and did
not result in the production of other proinflammatory
cytokines. Together with the fact that MCs are positioned
at surfaces that interface the external environment, these
Abbreviations used
BMMC: Bone marrowederived mast cell
CysLT: Cysteinyl leukotriene
dsRNA: Double-stranded RNA
HCMC: Human cultured mast cell
HMC-1: Human mast cell line 1
LAD: Laboratory of Allergic Disease mast cell line
MC: Mast cell
NF: Nuclear factor
PKR: Protein kinase R
polyI:C: Polyinosine-polycytidylic acid
PR8: UV-inactivated influenza virus
RSV: Respiratory syncytial virus
ssRNA: Single-stranded RNA
TLR: Toll-like receptor
From
a
the Laboratory of Allergic Diseases, National Institute of Allergy and
Infectious Diseases, National Institutes of Health, Bethesda;
b
the Centre
d’Immunologie de Marseille-Luminy, INSERM-CNRS, Marseille, and
c
the
Section of Immunobiology, Howard Hughes Medical Institute, Yale
University School of Medicine, New Haven.
Supported by the intramural program at the National Institutes for Health
Research. Dr Alexopoulou was supported in part by a National Institutes of
Health grant (P01AI36529).
Received for publication November 12, 2003; revised March 11, 2004;
accepted for publication March 12, 2004.
Reprint requests: Dean D. Metcalfe, MD, Laboratory of Allergic Diseases,
NIAID/NIH, 10 Center Drive, MSC 1881, Building 10, Room 11C209,
Bethesda, MD 20892-1881. E-mail:
dmetcalfe@niaid.nih.gov.
0091-6749/$30.00
Ó 2004 American Academy of Allergy, Asthma and Immunology
doi:10.1016/j.jaci.2004.03.049
174
Basic and clinical immunology
data suggest that MCs may contribute significantly to
innate immunity to viral infection and contribute to the
induction of adaptive immunity via the production of type
I IFNs.
METHODS
Human MC culture
Human peripheral blood CD34
+
progenitor cells were cultured as
described.
4
At 6 to 8 weeks of culture, aliquots of 2 3 10
4
cultured
cells were spun onto glass slides (Cytospin 2; Thermo Electron
Corporation, Houston, Tex) and stained with toluidine blue.
4
More
than 99% of the nonadherent cells contained metachromatic granules,
and flow cytometry showed them to be positive for Kit and FceRI
receptors.
Human MC line 1 (HMC-1) cells were cultured in Iscove medium
containing 10% FBS, 100 U/mL penicillin, and 100 lg/mL
streptomycin (Biosource International, Rockville, Md) in a humidi-
fied atmosphere of 5% CO
2
in air at 378C. Laboratory of Allergic
Disease mast cell line (LAD)e2 MCs
5
were cultured in serum free
media (StemPro-34 SFM; Life Technologies, Carlsbad, Calif)
supplemented with 2 mmol/L L-glutamine, 100 U/mL penicillin,
50 lg/mL streptomycin, and 100 ng/mL stem cell factor. The cell
suspensions were seeded at a density of 10
5
cells/mL and maintained
at 378C and 5% CO
2
.
Generation of bone marrowederived MCs
Bone marrowederived MCs (BMMCs) were generated from
femoral bone marrow cells of TLR-3 knockout mice and wild-type
littermates backcrossed on a C57BL/6 background.
6
Cells were
maintained in RPMI medium (Biosource International)
supplemented with 4 mmol/L L-glutamine, 1 mmol/L sodium
pyruvate, 100 U/mL penicillin, 100 lg/mL streptomycin, 50 lmol/
L b-mercaptoethanol, 0.1 mmol/L nonessential amino acids, and 30
ng/mL IL-3 (PeproTech, Rocky Hill, NJ). After 4 weeks of culture,
>99% of the cells were FceRI
+
/Kit
+
by FACS analysis and toluidine
blueepositive.
Bone marrow aspirate collect ion and flow
cytometry
The bone marrow aspirate mononuclear cell fraction containing
MCs was obtained after informed consent and was separated by using
Histopaque (Sigma-Alrich, St Louis, Mo) gradient centrifugation.
Contaminating red cells were lysed in 0.8% ammonium chloride
solution (Stem Cell Technologies, Vancouver, British Columbia,
Canada) for 10 minutes. Bone marrow aspirate mononuclear cell
fraction cells were stained with anti-TLR3-PE (eBioscience, San
Diego, Calif) or anti-Kit allophycocyanin (Caltag, Burlingame, Calif)
for 30 minutes at 48C, then analyzed on a FACSCalibur (BD
Biosciences, San Jose, Calif). For intracellular detection of IFN-a,
cells were fixed with 4% paraformaldehyde for 5 minutes, perme-
abilized with 0.1% saponin/PBS, blocked with 5% milk/PBS, and
stained with antieIFN-a (R&D Systems, Minneapolis, Minn).
RT-PCR
Total RNA was isolated from MCs by using the SNAP Total RNA
Isolation kit (Life Technologies, Carlsbad, Calif). Genomic DNA was
digested by incubating 10 lg total RNA with 2 U DNAse (Life
Technologies) in DNase buffer (200 mmol/L Tris-HCl, 20 mmol/L
MgCl
2
, 500 mmol/L KCl, pH 8.4; Life Technologies) and RNase-free
H
2
O for 10 minutes at room temp. RNA was precipitated with 3 mol/
LC
2
H
2
O
2
Na (pH 5.2; Sigma-Aldrich). Treated RNA (1 lg) was
reverse-transcribed by using 0.5 lg oligo(dT), reverse transcriptase
(RT) buffer, 10 mmol/L dithiothreitol, 10 mmol/L of each dNTP
(dATP, dCTP, dGTP, and dTTP), 2’-deoxynucleoside 5’-triphos-
phate-treated H
2
O, and 200 U Moloney murine leukemia virus RT
enzyme (all from Life Technologies) at 378C for 1 hour.
PCR was performed by using 1X PCR buffer, 0.8 mmol/L dNTP
mix, 20 lmol/L antisense primer, 20 lmol/L sense primer, 1.5 mmol/
L MgCl
2
, RNAse-free H
2
O, 2 lL cDNA, and 2.5 U Taq DNA
Polymerase (all from Life Technologies). The sequences of each
primer set are shown in
Table I. The PCR mixture was amplified at the
indicated annealing temperature for 20 to 35 cycles (
Table I). The
PCR product was then analyzed by 2% agarose gel electrophoresis
and visualized by ethidium bromide staining. The optimal PCR
conditions (amplification within the linear phase) for all primers were
determined by amplifying human spleen total RNA (BD Bioscience,
San Jose, Calif) over a range of cycle numbers, annealing
temperatures, primer concentrations, and MgCl
2
concentrations.
Quantitative real-time PCR
Quantitative real-time PCR assay of transcripts was performed by
using gene-specific fluorescently labeled primers and a 7700
Sequence Detector (Applied Biosystems, Foster City, Calif) as
described.
7
Primers and reagents were obtained from Invitrogen
(Chantilly, Va). Each primer set consisted of 1 labeled (6-carboxy
fluorescein [FAM] fluorescent reporter at the 59 end) and 1 unlabeled
primer. Sequences of the primers were as follows: IFN-a forward
primer, 59-FAM-GACCTTTTTGTGCTGAAGAGATTGAAGG5C-39;
IFN-a reverse primer, 59-TGATGGCAACCAGTTCCAGA-39;
human b-actin forward primer, 59-FAM-CAACTGTCTCCATGT-
CGTCCCAG5TG-39; and human b-actin reverse primer,
59-GACGAGGCCCAGAGCAAGA-39. Data were collected during
TABLE I. Primers for the human TLRs, signaling mole-
cules, and IFN-a/b used for RT-PCR analysis*
Gene Sequence Size Tm Cycles
TLR-1 tgaatatcagcaaggtcttgct 432 54 30
catctgtgtagtcatttcagct
TLR-2 gagcatctgataatgacagagtta 773 60 40
gtgtcagtaagtatatttgaaga
TLR-3 gtttggagcaccttaacatggaa 454 60 30
tgcttagatccagaatggtcaag
TLR-4 gcatacttagactactacctcgat 342 60 35
aataacaccattgaagctcagatc
TLR-5 acaccaatgtcactatagctg 645 50 30
tgtacaaagcctctgatggat
TLR-6 cttggaaatgcctggtcagagt 544 60 35
atctgaaaacagagtcagtaagc
TLR-7 gacctaagtggaaattgccct 538 60 35
ctcttgaatctcctgaaggtg
TLR-8 aacagaatatcaccgttggtaaa 293 60 35
ttcagttccacttaacacttgag
TLR-9 ggacctctggtactgcttcca 150 54 45
aagctcgttgtacacccagtct
TLR-10 tgctcatctgcatctaaatactgt 671 60 35
agtctccagtttattgccattcaa
IFN-a
(all types)
agaatctctcctttctcctg 914 50 35
catctgtgtagtcatttcagct
IFN-b tgtctcctccaaattgctctcc 635 60 35
gcatctgctggttgaagaatgc
b-actin atctggcac cacaccttctacaat-
gagctgcg
838 60 25
cgtcatactcctgcttgctgatcca-
catctgc
*All sequences are in the 5 9 to 39 orientation.
J ALLERGY CLIN IMMUNOL
VOLUME 114, NUMBER 1
Kulka et al 175
Basic and clinical immunology
the annealing/extension phase of PCR and analyzed by using the
comparative C
t
method.
7
b-Hexosaminidase release assay
A total of 2 3 10
5
cells were washed and resuspended in buffer (10
mmol/: HEPES, 137 mmol/L NaCl, 2.7 mmol/L KCl, 0.38 mmol/L
Na
2
HPO
4
7H
2
O, 5.6 mmol/L glucose, 1.8 mmol/L CaCl
2
2H
2
O, 1.3
mmol/L MgSO
4
7H
2
O, 0.04% BSA; pH 7.4) and stimulated with
various concentrations of LPS (from Escherichia coli serotype
055:B5; Sigma-Aldrich), peptidoglycans (from Staphylococcus
aureus; Sigma-Aldrich), polyI:C (Amersham Biosciences,
Piscataway, NJ), CpG-A DNA (Coley Pharmaceuticals, Kanata,
Ontario, Canada), and flagellin (Axxora LLC, San Diego, Calif). In
the case of FceRI-mediated stimulation, human cultured MCs
(HCMCs) were sensitized with human IgE antie4-hydroxy-3-
nitrophenylacetyl (NP) (1 lg/mL; Serotec, Raleigh, NC) overnight
and stimulated with NP-BSA (Sigma-Aldrich) at various con-
centrations. The b-hexosaminidase in supernatants and cell lysates
was quantified by hydrolysis of p-nitrophenyl N-acetyl-b-D-
glucosamide (Sigma-Aldrich) in 0.1 mol/L sodium citrate buffer
(pH 4.5) for 90 minutes at 378C. The percentage of b-hexosaminidase
release was calculated as percent of total content.
Cytokine ELISAs
Human cultured MCs were washed with media and suspended at
1 3 10
6
cells per well, then stimulated with LPS, peptidoglycan,
polyI:C, CpG, or antigen for indicated times. In some cases, cells
were preincubated with SP600125 (0.1 lmol/L; a JNK inhibitor;
Biosource), SB202190 (30 l g/mL, an inhibitor of p38), SN50 (50 lg/
mL; an inhibitor of nuclear factor [NF]ejB; Biosource), actinomycin
D(5lg/mL; transcription inhibitor; Biosource), antieTLR-3 poly-
clonal antibody (5 lg/mL; clone Q-18 or L-13; Santa Cruz
Biotechnology, Santa Cruz, Calif), antieTLR-2 (5 lg/mL; clone
N-17; Santa Cruz Biotechnology) or antieTLR-4 (5 lg/mL; clone C-
18; Santa Cruz Biotechnology) for 1 hour, then stimulated with
polyI:C. Cell free supernatants were isolated and analyzed for
cysteinyl leukotriene (CysLT), human cytokines (IFN-a, TNF, IL-5,
IL-1b, and GM-CSF), and murine cytokines (IFN-a and TNF) by
using commercial ELISA kits (R&D Systems).
Western immunoblot
Human cultured MCs were washed with PBS and 1 3 10
6
cells
lysed in buffer containing lithium dodecyl sulfate sample buffer (Life
Technologies), 10% b-mercaptoethanol (Sigma-Aldrich), 0.1 mol/L
DTT (Sigma-Aldrich), and protease inhibitor cocktail (Roche,
Indianapolis, Ind). Whole cell lysates (30 lg) were separated on
4% to 12% Bis-Tris SDS-PAGE gels (Life Technologies) and
transferred onto nitrocellulose membranes. The membranes were
blocked with 3% milk in TRIS-buffered salinee0.05% Tween for 1
hour and then stained with primary antibodies, antieTLR1 to TLR9
(Santa Cruz Biotechnology), antiephospho-stress-activated protein
kinase/JNK (Thr183/Tyr185; Cell Signaling Technology, Beverly,
Mass), antiephospho-p38 MAP kinase (Thr180/Tyr182; Cell
Signaling Technology), anti—phosphoeNF-jB p65 (Ser536; Cell
Signaling Technology), or antiactin (Sigma-Aldrich) for 1 hour at
room temperature. The membranes were washed with TRIS-buffered
salineeTween 3 times and stained with the secondary antibody sheep
antirabbit horseradish perioxidase (Jackson ImmunoResearch
Laboratories, West Grove, Pa), donkey antigoat HRP (Santa Cruz
Biotechnology), or goat antimouse HRP (Santa Cruz Biotechnology)
for 1 hour. The nitrocellulose membranes were developed with
chemiluminescence reagent (Life Technologies) for 1 minute and
exposed to high-performance chemiluminescence film for 30
minutes.
Viral infection
Human cultured MCs were washed with media and resuspended at
1 3 10
6
cells/mL in a 24-well plate. Cells were then treated with 8
plaque-forming units/cell of respiratory syncytial virus (RSV),
reovirus type 1, Lang (10 PFU/cell; a gift from Terence Dermody,
Vanderbilt University School of Medicine, Nashville, Tenn), or UV-
inactivated influenza virus (40 hemagglutination units/mL; a gift
from John Yewdell, National Institute of Allergy and Infectious
Diseases, National Institutes of Health, Bethesda, Md) and incubated
for 3 days at 378C. Cell-free supernatants were assayed for IFN-a
production by ELISA (R & D Systems).
Statistical analysis
Experiments were conducted in triplicate or with MCs obtained
from 3 separate donors, and values represent means of n = 3 ±
SEMs. P values were determined by 1-way ANOVA (between
groups) or Student t test.
RESULTS
dsRNA induces IFN-a production by human
MCs
Double-stranded RNA, a synthetic mimic of viral RNA,
has been shown to induce type I IFNs in several cell
types, including dendritic cells.
8,9
For these studies, we
stimulated LAD, HMC-1, and HCMCs with polyI:C for
0 to 24 hours, and total RNA samples were analyzed for
the presence of IFN-a and IFN-b mRNA by using RT-
PCR. PolyI:C induced IFN-a and IFN-b mRNA expres-
sion in LAD and HMC-1 cells, with gene induction
occurring as early as 30 minutes (
Fig 1, A). HCMCs
constitutively expressed low levels of IFN-a mRNA, and
expression was increased after polyI:C exposure. PolyI:C
did not induce message for IFN-b in HCMCs. The in-
crease in IFN-a mRNA after polyI:C treatment of HCMCs
was confirmed by real-time PCR analysis. As shown in
Fig 1, B, IFN-a mRNA expression increased after polyI:C
treatment and reached a maximum at 3 to 5 hours.
To determine whether the increase in IFN-a mRNA was
accompanied by secretion of IFN-a protein, HCMCs were
treated with polyI:C (10 lg/mL) for 0 to 24 hours, and cell-
free supernatants were analyzed by ELISA (
Fig 1, C).
Consistent with RT-PCR analysis, polyI:C induced IFN-a
production, which continued over a period of 8 hours.
Stimulation of HCMCs with polyI:C, polyA:U, polyG:C,
poly C, and polydI:dC showed that polyI:C was the most
potent inducer of IFN-a production (
Fig 1, D) results
similar to those with other cell types.
6
We next verified that human MCs produce type I IFNs
in response to viral exposure. HCMCs were treated with
UV-inactivated influenza virus (PR8), type 1 reovirus,
RSV, and polyI:C dsRNA at 378C for 3 days. All 3 viruses
induced substantial production of IFN-a (PR8, 407 ±
31.9 pg/mL; type 1 reovirus, 281.4 ± 17.6 pg/mL; and
RSV, 503.4 ± 21.8 pg/mL).
Human MCs express TLR-3 as well as other
TLRs
Because dsRNA is reported to signal via TLR-3, we
examined HMC-1, LAD, HCMCs cultured for 4 weeks,
J ALLERGY CLIN IMMUNOL
JULY 2004
176 Kulka et al
Basic and clinical immunology
and HCMCs cultured for 8 weeks for message and protein
expression of TLRs. Previous reports had shown that
human cord bloodederived MCs express mRNA for
TLR-1, TLR-2, TLR-4, and TLR-6.
10,11
Analysis re-
vealed that all human MC types expressed TLR-3, TLR-5,
TLR-7, and TLR-9 mRNA (Fig 2, A). HCMCs also
expressed TLR-1, TLR-2, TLR-4, TLR-6, and TLR-8 (
Fig
2, A
). However, mature HCMCs (at 8 weeks of culture) did
not express TLR-8. These observations were confirmed by
Western blot analysis by using antibodies specific for
TLR1 to TLR9. HCMCs (mature, cultured for 8 weeks)
similarly expressed protein for all TLRs except TLR-8,
and all MC types expressed TLR-3, TLR-5, TLR-6, TLR-
7, and TLR-9 (
Fig 2, B). The bone marrow aspirate
mononuclear cell fraction containing MCs was also tested
for TLR-3 expression by flow cytometry. MCs are readily
identified as a population highly expressing CD117
(Kit
12
), and these cells also expressed TLR-3 (Fig 3).
TLR-3 antibodies inhibit dsRNA activation of
human MCs, and MCs from TLR-3 knockout
mice show impaired responses
To explore whether polyI:C-induced IFN-a production
involved TLR-3, HCMCs were preincubated with 2
polyclonal antieTLR-3 antibodies (clone Q-18 and L-
13), then stimulated with polyI:C (10 lg/mL) for 24 hours.
IFN-a release was then measured by ELISA (
Fig 3, A).
Preincubation with either antieTLR-3 antibody inhibited
polyI:C-induced IFN- a production by more than 40%.
Isotype, antieTLR-2, and antieTLR-4 antibodies did not
have a significant effect on polyI:C-induced IFN-a
production.
Bone marrowederived MCs from TLR-3 knockout
mice have a significantly (P < .01) impaired response to
polyI:C (
Fig 3, B) but respond normally to LPS (Fig 3, C)
and antigen (
Fig 3, D). This impaired MC response is
similar to the impaired polyI:C response of macrophages
and splenocytes from TLR-3
e/e
mice.
6
TLR-3
e/e
BMMCs expressed the same level of Kit and FceRI
receptors as wild-type BMMCs and degranulated
normally in response to antigen (data not shown).
Human cultured MCs do not secrete IFN-a in
response to LPS, peptidoglycan, flagellin, or
antigen
Because initial studies had shown that MCs express
several TLRs (
Fig 2), IFN-a production in response to
diverse TLR ligands was next determined. HCMCs did
FIG 1. A, RT-PCR analysis of IFN- a/b mRNA production after dsRNA (polyI:C, 10 lg/mL) treatment for 0 to 8
hours. B, Real-time PCR analysis of IFN-a gene expression in HCMCs treated with dsRNA (polyI:C, 10 lg/mL).
C, ELISA analysis of IFN-a production from HUMCs stimulated with dsRNA (polyI:C, 10 lg/mL). D, Flow
cytometry analysis of IFN-a production after HCMC stimulation with polyI:C, polyA:U, polyC:G, polyC, and
polydI:dC (all at 10 lg/mL) for 24 hours (n = 3).
J ALLERGY CLIN IMMUNOL
VOLUME 114, NUMBER 1
Kulka et al 177
Basic and clinical immunology
