Inulin-type fructans with prebiotic properties counteract GPR43 overexpression and
PPARγ-related adipogenesis in the white adipose tissue of high-fat diet-fed mice☆
Evelyne M. Dewulf
a,1
, Patrice D. Cani
a,1
, Audrey M. Neyrinck
a
, Sam Possemiers
b
, Ann Van Holle
b
,
Giulio G. Muccioli
c
, Louise Deldicque
d
, Laure B. Bindels
a
, Barbara D. Pachikian
a
, Florence M. Sohet
a
,
Eric Mignolet
e
, Marc Francaux
d
, Yvan Larondelle
e
, Nathalie M. Delzenne
a,
⁎
a
Louvain Drug Research Institute, Metabolism and Nutrition Research Group, LDRI, Université Catholique de Louvain, 1200 Brussels, Belgium
b
Laboratory of Microbial Ecology and Technology, Ghent University, 9000 Ghent, Belgium
c
Bioanalysis and Pharmacology of Bioactive Lipids Laboratory, LDRI, Université catholique de Louvain, 1200 Brussels, Belgium
d
Research Group in Muscle and Exercise Physiology, Université catholique de Louvain, 1348 Louvain-La-Neuve, Belgium
e
Institut des Sciences de la Vie, Université catholique de Louvain, 1348 Louvain-la-Neuve, Belgium
Received 9 February 2010; received in revised form 4 May 2010; accepted 29 May 2010
Abstract
Inulin-type fructans (ITF) are nondigestible/fermentable carbohydrates which are able — through the modification of the gut microbiota — to counteract
high-fat (HF) diet-induced obesity, endotoxemia and related-metabolic alterations. However, their influence on adipose tissue metabolism has been poorly
studied until now. The aim of this study was to assess the influence of ITF supplementation on adipose tissue metabolism, by focusing on a G protein-coupled
receptor (GPR), GPR43, as a potential link between gut fermentation processes and white adipose tissue development. Male C57bl6/J mice were fed a standard
diet or an HF diet without or with ITF (0.2 g/day per mouse) during 4 weeks. The HF diet induced an accumulation of large adipocytes, promoted peroxisome
proliferator activated receptor gamma (PPARγ )-activated differentiation factors and led to a huge increase in GPR43 expression in the subcutaneous adipose
tissue. All those effects were blunted by ITF treatment, which modulated the gut microbiota in favor of bifidobacteria at the expense of Roseburia spp. and of
Clostridium cluster XIVa. The dietary modulation of GPR43 expression seems independent of endotoxemia, in view of data obtained in vivo (acute and
chronic lipopolysaccharides treatment). In conclusion, ITF, which promote gut fermentation, paradoxically counteract GPR43 overexpression induced in the
adipose tissue by an HF diet, a phenomenon that correlates with a beneficial effect on adiposity and with potential decrease in PPARγ-activated processes.
© 2010 Elsevier Inc. All rights reserved.
Keywords: Gut microbiota; prebiotics; adipose tissue; high-fat feeding; GPR43; PPARγ
1. Introduction
Obesity, which is characterized by an excess of fat mass, results
from interactions between genetic and environmental factors. It is
well known that a fat-enriched diet leads, especially in genetically
predisposed individuals, to an accumulation of adipose tissue and to
the development of metabolic alterations associated to weight gain. In
addition, an innovati ve hypothesis has recently be en proposed
whereby another important aspect, the microbial ecology in humans,
could be an important factor affecting energy homeostasis [1–4].
Over the past 5 years, the implication of the gut microbiota in
energy homeostasis has been highlighted in several experimental
studies. Indeed, Backhed et al. showed that germ-free mice resist to
high-fat (HF) diet-induced obesity and that the conventionalization of
adult germ-free mice produces a rapid increase in body fat content
despite lower food intake [5,6]. Additi onally, changes in gut
microbiota composition were shown in different mice models of
obesity, including ob/ob mice, and obese mice fed an HF-rich diet
[7–10]. Several molecular targets were proposed which may link
microbes-related events occurring in the colon with adipose tissue
development, such as the so-called fasting-induced adipose factor.
Conventionalization experiments showed that its intestinal expres-
sion is blunted after microbial colonization of the gut, thereby
allowing increased lipoprotein-lipase (LPL) dependent fat storage in
the adipose tissue [5]. Other molecular targets have been proposed
recently, among which G protein-coupled receptors (GPR) 41 and 43
which are activated by short chain fatty acids (SCFA) generated by
bacterial gut fermentation of nondigestible carbohydrates [11–13].
Among these two receptors, GPR43 — which is highly expressed in
adipocytes — seems to be implicated in adipose tissue metabolism.
Previous works showed that acetate and propionate inhibit isopro-
terenol-induced lipolysis in 3T3-L1 adipocytes [14] and also that the
A
vailable online at www.sciencedirect.com
Journal of Nutritional Biochemistry xx (2010) xxx – xxx
☆
This project was supported a FNRS grant (n°1.5.095.09F).
⁎
Corresponding author. Louvain Drug Research Institute, Nutrition and
Metabolism Research Group, Université catholique de Louvain, PMNT Unit,
Avenue Mounier 73/69, 1200 Brussels, Belgium. Tel.: +32 02 764 73 67;
fax: +32 02 764 73 59.
E-mail address: nathalie.delzenne@uclouvain.be (N.M. Delzenne).
1
Equally contributed to this work.
0955-2863/$ - see front matter © 2010 Elsevier Inc. All rights reserved.
doi:10.1016/j.jnutbio.2010.05.009
activation of GPR43 by acetate in vivo results in reduced plasma levels
of free fatty acids, showing the inhibition of lipolysis [15]. These
effects are mediated through GPR43 activation since they a re
abolished in GPR43-knockout animals [15]. In addition to the
potential implication of GPR43 in lipolysis, its expression is induced
in vitro in differentiating adipocytes. In fact, acetate and propionate
stimulate adipogenesis via GPR43, since blocking GPR43 expression in
3T3-L1 cells, using siRNA, inhibits differentiation as well as fat
accumulation in cells [14].
Given the important role of the gut microbial ecology in
association with obesity, several studies have focused on the
hypothesis that the onset of obesity may be influenced by targeted
modification of the gut microbiota by specific nutrients. Indeed, the
decrease in bifidobacteria occurring in obese mice fed an HF, sugar-
free diet is counteracted through the administration of nondigestible
oligosaccharides such as inulin-type fructans (ITF). Those compounds
have been considered as prebiotics for year, namely, because they
promote bifidobacteria development in the gut, with beneficial effects
for host [16]. Indeed, we have already shown that, in several models
of diet-induced or genetic obesity [8,10,17], ITF supplementation
counteracts white adipose tissue accumulation and other obesity
related metabolic alterations such as endotoxemia, hepatic insulin
resistance or gut barrier dysfunction. However, the adipose tissue
metabolism in these conditions has been unexplored until now.
The aim of this study was to investigate the impact of gut
microbiota modulation occurring upon ITF supplementation, on
adipose tissue metabolism (lipid storage, adipogenesis and lipolysis)
in a mouse model of diet-induced obesity, and to relate those effects
with the changes in gut microbiota composition (prebiotic effect). We
focused on the influence of ITF on GPR43 expression and related
adipose tissue targets implicated in adipocyte differentiation:
peroxisome proliferator activated receptor gamma (PPARγ), CCAAT-
enhancer-binding protein α (C/EBPα) and adipocyte-specific genes
such as the adipocyte P2 gene (aP2) [18].
2. Methods and materials
2.1. Animals
Ten-week-old male C57bl6/J mice (Charles River, Brussels, Belgium) were housed
in groups of four mice per cage (eight per group) in a 12-h light/dark cycle (lights off at
6 p.m.) and were given free access to diet and water. The mice were separated into
three groups: the control (CT) group was fed a CT diet (AO4, SAFE, Villemoison-sur-
Orge, France), the HF group received an HF diet (Research Diets, New Brunswick, NJ,
USA) and the HF-ITF group was fed the HF diet supplemented with 0.2 g/day per mouse
of ITF prebiotics (oligofructose from Orafti, Oreye, Belgium) in water. Mice were
treated during 4 weeks. The HF diet contained 60% lipids (soybean oil and lard), 20%
protein, and 20% carbohydrates as energy content. Food intake, taking into account
spillage, was recorded twice a week. Water consumption was also recorded twice a
week to analyze prebiotic intake.
2.2. Blood and tissue samples
At the end of the experiment, 6-h-fasted mice were anaesthetized by intraperi-
toneal injection of 100 mg/kg of ketamine and 10 mg/kg of xylazine (Anesketin,
Eurovet, Bladel, the Netherlands; Rompun, Bayer Belgium, Sint-Truiden, Belgium).
Retro-orbital blood was collected with haematocrit capillaries in EDTA tubes,
centrifuged (3 min, 13000× g), and plasma was stored at −80°C. The liver was
removed, clamped in liquid N
2
and kept at −80°C. Full and empty caecum and fat
tissues (subcutaneous, visceral and epipidymal) were collected, weighed and frozen in
liquid N
2
. Before freezing the subcutaneous adipose tissue, explants of 20 mg were
collected in order to evaluate the lipolytic activity (see below).
2.3. Gut microbiota analysis
For analysis of the microbial community composition, metagenomic DNA was
extracted from the caecal content of all mice, using the QIAamp DNA stool mini kit
(Qiagen, Venlo, Netherlands) according to the manufacturer's instructions. Denaturing
Gradient Gel Electrophoresis (DGGE) on total bacteria, bifidobacteria, lactobacilli and
the Bacteroides-Prevotella was performed to study the qualitative effect of the
treatment on the structure and composition of the intestinal microbial community.
DGGE with a 45–60% denaturant gradient were used to separate the polymerase chain
reaction (PCR) products obtained with a nested approach for the 16S rRNA genes of
bifidobacteria (primers BIF164f-BIF662r) and lactobacilli (SGLAB0158f-SGLAB0667)
[19] and of the Bacteroides-Prevotella cluster (FD1, RbacPre)[20]. The first PCR round
was followed by a second amplification with primers 338F-GC and 518R. The latter
primers were also used to amplify the 16S rDNA of all bacteria on total extracted DNA.
The DGGE patterns obtained were subsequently analysed using the Bionumerics
software version 5.10 (Applied Maths, Sint-Martens-Latem, Belgium). In brief, the
calculation of the similarities was based on the Pearson (product–moment) correlation
coefficient. Clustering analysis was performed using the unweighted pair group
method with arithmetic mean clustering algorithm to calculate the dendrograms of
each DGGE gel and a combination of all gels. The latter was performed on a created
composite dataset. The composite dataset of the 4 DGGE patterns was also used to
perform principal coordinate analysis (PCoA). PCoA ordinations were calculated using
the Pearson product-moment correlation coefficient. Within each character set, this
coefficient subtracts each character from the average value and divides it by the
variance of the character set.
Quantitative PCR (qPCR) was performed to study the quantitative effect of the
treatment on the composition of the intestinal microbial community. qPCR for total
bacteria (using primers PRBA338f and P518r) and specific for bifidobac teria,
lactobacilli or the Eubacterium rectal– Clostridium coccoides cluster were performed
as reported by Possemiers et al. [21]. qPCR for Roseburia spp. was performed as
described before [22], using the primers Ros-F1 and Ros-R1. qPCR for Firmicutes and
Bacteroidetes was performed according to Guo et al. [23], using respectively the
primers Firm934F-Firm1060R and Bact934F-Bact10 60R. For the latter three protocols,
the Power SYBR Green PCR Master kit (Applied Biosystems, Foster City) was used. The
qPCR for Bacteroides-Prevotella spp. was performed as described by Rinttilä et al. [24],
using the qPCR Core kit for SYBR Green I (Eurogentec, Seraing, Belgium) and primers
Bacter140f and Bacter140r. All qPCR were performed with an ABI PRISM SDS 7000
Sequence Detection System (Applied Biosystems, Nieuwerkerk a/d Ijssel, the
Netherlands). The statistical analysis was done on logarithmic values.
2.4. Adipose tissue morphometry
The mean adipocytes size was estimated on paraffin-embedded, hematoxylin-
stained, eosin-counterstained sections of subcutaneous tissue. The number of
adipocytes per microscopic field (density) was determined at a magnification of
×100. Total count ranged from 2900 to 5700 cells per condition. The mean surface area
of the adipocytes (μm
2
) was calculated using image analyzer software (Motic Image
Plus 2.0 ML).
2.5. Lipolytic activity
Fresh explants (20 mg) of subcutaneous adipose tissue (SAT) were incubated with
carbogen during 2 h at 37°C in a Krebs solution [NaCl 118 mM, KCl 4.8 mM, KH
2
PO
4
1.2 mM, MgSO
4
1.2 mM, CaCl
2
1.25 mM, NaHCO
3
25 mM, glucose 5 mM and 2.5% bovine
serum albumin (BSA) free fatty acid] plus or minus insulin 10nM [25]. After incubation,
tissues were frozen in liquid nitrogen and conserved at −80°C. The incubation medium
was frozen at −20°C until measurement of nonesterified fatty acids (NEFA) by
enzymatic reactions and spectrophotometric detectio n of reaction end-products
(Randox, United Kingdom). Lipolytic activity is expressed in nanomoles of NEFA
released in the medium per g of adipose tissue after two hours of incubation with or
without insulin [26]. The level of insulin-induced lipolysis inhibition corresponds to
NEFA concentration in presence of insulin minus NEFA released in basal conditions.
2.6. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE)
and immunoblotting
Frozen explants of SAT incubated for evaluating the lipolytic activity were
homogenized in radioimmunoprecipitation assay (RIPA) buffer [25 mM Tris-HCl, 150
mM NaCl, 0.1% SDS, 1% Tergitol type NP-40, 1% sodium deoxycholate, a phosphatase
inhibitor cocktail and a protease inhibitor cocktail]. The homogenates were then
centrifuged for 20 min at 13,000×g and the supernatant was removed. This step was
repeated three times. Supernatants were combined with Laemmli sample buffer and
separated by SDS-PAGE. After electrophoretic separation at 40 mA, the proteins were
transferred to a polyvinylidene fluoride (PVDF) membrane at 80 V for 2 h, followed
by western blot analysis. Membranes were then incubated in a 5% Blotto solution.
Subsequently, membranes were incubated overnight at 4°C with an anti-phospho-
Akt (Ser 473, Cell Signaling) diluted (1:1000) in Tris-buffered saline Tween-20
(TBST) containing 1% BSA. Membranes were washed in TBST and incubated for 1
h at room temperature in a secon dary antibody conjugated to horseradish
peroxidase (1:10,000; Sigma, St. Louis, MO, USA). After additional washes,
chemiluminescence detection was carried out using an Enhanced Chemiluminescent
Western blotting kit (ECL Plus, Amersham Biosciences) and hyperfilms (Hyperfilm
ECL, Amersham Biosciences). Then, the membranes were stripped and re-probed
with an antibody recognizing the total form of Akt (Cell Signaling) to which all data
were reported. The films were scanned with an ImageScanner using the Labscan
software and quantified with the Image Master 1D Image Analysis Software
(Amersham Biosciences).
2 E.M. Dewulf et al. / Journal of Nutritional Biochemistry xx (2010) xxx–xxx
2.7. Blood biochemical analysis
Homeostasis Model Assessment (HOMA) was calculated as follows: [fasted
glycemia (mM) ⁎fasted insulinemia (μU/ml)]⁎22.5. Fasted glycemia was determined
by enzymatic reactions and spectrophotometric detection of reaction end-products
(Glucose PAP, Elitech Diagnostics). Plasma insulin concentration was determined in 5
μl of plasma using an ELISA kit (Mercodia, Upssala, Sweden), following the
manufacturer's instructions.
2.8. Real-time quantitative PCR
Total RNA was isolated from subcutaneous adipose tissue using the TriPure
isolation reagent kit (Roche Diagnostics Belgium, Vilvoorde). cDNA was prepared by
reverse transcription of 1 mg total RNA using the Kit Reverse transcription System
(Promega, Leiden, The Netherlands). Real-time PCR were performed with the StepOne
Plus real-time PCR system and software (App lied Biosystems, Den Ijssel, The
Netherlands) using SYBR-Green (Applied Biosystems) for detection. Ribosomal protein
L19 (RPL19) RNA was chosen as housekeeping gene. The targeted mouse genes are
detailed in Table 1. All samples were run in duplicate in a single 96-well reaction plate
and data were analyzed according to the 2
−ΔCT
method. The identity and purity of the
amplified product was checked through analysis of the melting curve carried out at the
end of amplification.
2.9. Fatty acid profile analysis in adipose tissue
To determine the fatty acid profile in subcutaneous adipose tissue, 20 mg of tissue
were homogenized in 3 ml of 2:1 chloroform:methanol. Homogenates were filtrated,
and filters were rinsed with methanol and chloroform. Samples were centrifuged after
addition of KCl 0.88%, the upper phase was removed and KCl 0.88%:MeOH (1:1) was
added before a second centrifugation. The chloroform phase was evaporated under
nitrogen flux. Fatty acids were methylated in a solution of KOH in methanol (0.1 mol/L)
at 70°C for 60 min, then in a solution of HCl in methanol (1.2 mol/L) at 70°C for 20 min,
and finally extracted with hexane. Fatty acid methyl esters (FAME) were quantified by
a gas–liquid chromatograph (GC Trace ThermoQuest, Thermo-Finnigan, Milan, Italy)
equipped with a flame ionization detector, automatic injector and a fused silica
capillary column (100 m, 25.20 mm i.d.) coated with a film of biscyanopropyl
polysiloxane (RT-2560; Restek, Interscience, Belgium) using H
2
as the carrier gas
operated at a constant pressure of 200 kPa. Injection was on column in order to inject
the entire sample into the column head. The initial oven temperature was 80°C,
increased at 25°C/min to 175°C (held for 25 min), then increased at 10°C/min to 205°C
(held for 4 min), then increased at 10°C/min to 225°C (held for 20 min) and finally
decreased at 20°C/min to 80°C. The temperature of the flame ionisation detector was
maintained at 255°C. Hydrogen flow to the detector was 35 ml/min, and airflow was
350 ml/min. Each peak was identified and quantified by comparison of retention times
with pure FAME standards (Alltech Associates, Deerfield, IL, USA; except CLA isomers
from Nu-Chek Prep, Elysian, MN, USA). Each FA was expressed as a percentage of FAME
reported (identified).
2.10. Adipose tissue explants culture
Subcutaneous adipose depots of 20 ten-week-old male C57bl6/J mice were
precisely dissected; all visible vessels, particles, and conjunctive tissue were removed.
Fat tissue was cut with scissors into small pieces (4 mm
3
) pooled and placed in Krebs
buffer, pH 7.4, containing 2% (w/v) free fatty acid–BSA and penicillin (100 IU/ml),
streptomycin (100 μg/ml), amphotericin B (2.5 μl/ml) (Invitrogen); 250 mg of adipose
tissue were rinsed in phosphate-buffered saline and incubated in 100-mm petri dishes
containing 10 ml MEM with Earle's salts (Invitrogen) supplemented with 0.5% free
fatty acid-BSA, penicillin (100 IU/ml), streptomycin (100 μg/ml), amphotericin B (2.5
μl/ml) (Invitrogen) and then cultured. All conditions were carried out in three different
dishes (n=3). The dishes were cultured for 24 h at 37°C in a 5% CO
2
atmosphere. The
basal concentration of glucose in fresh medium was 5 mmol/L and those of cortisol and
insulin were extremely low (≈0.5 nmol/L and 3 pmol/L, respectively). Different
pharmacological agents were used in various combinations in accordance with the
experimental protocols. Troglitazone (10 μM) (Sigma) and GW9662 (10 μM) (Sigma)
were diluted in DMSO which served as CT condition. Cell viability did not change over
the course of culture (not shown). At the end of the experiment, the adipose material
was rinsed in phosphate-buffered saline, collected, immediately frozen in liquid
nitrogen, and stored at −80°C until subsequent mRNA analysis.
2.11. Chronic load with lipopolysaccharides (LPS)
Ten-week-old male C57bl6/J mice (Charles River, Brussels, Belgium) were
housed in a controlled environment in a 12-h light/dark cycle (lights off at 6:00 pm)
and were given free access to diet and water. Mice were implanted subcutaneously
with an osmotic minipump (Alzet Model 2004; Alza, Palo Alto, CA, USA) as
previously described [27]. The pumps were filled either with Tween 0.1%/saline or
LPS (from Escherichia coli 055:B5; Sigma) to infuse 300 μg/kg/day for 4 weeks. At the
end of the experiment, 6-h-fasted mice were anaesthetized as described supra. Fat
tissues (subcutaneous, visceral and epipidymal) were collected, weighed and frozen
in liquid N
2
.
2.12. Acute load with LPS
Ten-week-old male C57bl6/J mice (Charles River, Brussels, Belgium) were housed
in groups of three mice per cage (six per group) in a 12-h light/dark cycle (lights off at
6:00 pm) and were given free access to diet (AO4, SAFE, Villemoison-sur-Orge, France)
and water for acclimatizing. After 2 h of fasting, mice were intraperitoneally injected
either with saline solution (CT group) or with LPS (5 mg/kg, from Escherichia coli 055:
B5; Sigma) (LPS group). Four hours after injection, mice were anaesthetized as
described supra. Vena cava blood was collected in EDTA tubes, centrifuged (3 min,
13000×g) and plasma was stored at −80°C. Fat tissues (subcutaneous and epipidymal)
were collected, weighed and frozen in liquid N
2
.
All mice experiments were approved by the local committee and the housing
conditions were as specified by the Belgian Law of November 14, 1993 on the
protection of laboratory animals (agreement no. LA 1230314) in accordance with the
declaration of Helsinki.
2.13. Statistical analysis
Results are pr esented as mean±S.E.M. Statistical significance of di fference
between groups was assessed either by one-way analysis of variance (ANOVA)
followed by post hoc Tukey's multiple comparison tests when comparing three groups
or more, or by a Student's t test when comparing 2 groups (Graph-Pad Prism Software,
San Diego, CA, USA; www.graphpad.com). Data with different superscript letters are
significantly different ( Pb.05) according to the post hoc ANOVA statistical analysis.
⁎Significantly different from the CT group (Pb.05, Student's t test).
3. Results
3.1. ITF promote selective changes in caecal microbial composition
The weight of the caecal content is considered as a measure for the
extent of bacterial fermentation and changes in this weight are
therefore related with changes in the microbial activity or composi-
tion in the caecum. As compared to the CT diet, administration of the
HF diet induced a significant decrease in the caecal content, an effect
which was h owever counteracted by the co-ad ministration of
prebiotics with the HF diet (CT: 0.268±0.018
a
; HF: 0.114±0.015
b
;
HF-ITF: 0.246±0.025
a
g). Changes were also observed in the bacterial
counts as quantified by qPCR (Fig. 1A). Administration of the HF diet
induced a decrease in total bacterial counts and in the counts of most
Table 1
Sequences for the primers used in real-time quantitative PCR
GenBank accession no. Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
RPL19 NM_009078.1 GAAGGTCAAAGGGAATGTGTTCA CCTTGTCTGCCTTCAGCTTGT
GPR43 NM_146187.3 TTCTTACTGGGCTCCCTGCC TACCAGCGGAAGTTGGATGC
PPARγ NM_011146.2 CTGCTCAAGTATGGTGTCCATGA TGAGATGAGGACTCCATCTTTATTCA
aP2 NM_024406.1 GATGCCTTTGTGGGAACCTG GCCATGCCTGCCACTTTC
C/EBPα NM_007678.3 GAGCCGAGATAAAGCCAAACA GCGCAGGCGGTCATTG
LPL NM_008509.2 TCTGTACGGCACAGTGG CCTCTCGATGACGAAGC
CD36 NM_007643.3 GCCAAGCTATTGCGACATGA ATCTCAATGTCCGAGACTTTTCAAC
TLR-4 NM_021297.2 GCAGAAAATGCCAGGATGATG AACTACCTCTATGCAGGGATTCAAG
F4/80 NM_010130.2 TGACAACCAGACGGCTTGTG CAGGCGAGGAAAAGATAGTGT
CD36, cluster of differentiation 36; TLR-4, toll like receptor 4.
3E.M. Dewulf et al. / Journal of Nutritional Biochemistry xx (2010) xxx–xxx
Fig. 1. (A) Gut microbiota analysis in ceacal content of mice fed a CT diet, an HF diet or an HF-ITF diet after 4 weeks of treatment. Data are mean±S.E.M. Data with different superscript
letters are significantly different at Pb.05, according to the post hoc ANOVA statistical analysis. (B) PCoA was used to explore the similarity within a composite dataset consisting of
DGGE fingerprints of total bacteria, bifidobacteria, lactobacilli and the Bacteroides-Prevotella cluster. The DGGE analysis was performed on the cecum content of mice (n=8/group) fed
a CT diet (black symbols), an HF diet (grey symbols) or an HF-ITF diet (white symbols) during 4 weeks.
4 E.M. Dewulf et al. / Journal of Nutritional Biochemistry xx (2010) xxx–xxx
of the analyzed bacterial groups, except for bifidobacteria. As
expected, the co-administration of the HF diet with ITF significantly
increased bifidobacterial counts by 100-fold. However, ITF treatment
also led to a drop in Roseburia spp. and of Clostridium cluster XIVa.
Changes in the bacterial composition were also assessed with
DGGE fingerprinting analysis of different bacterial groups. The
combination of all different fing erprints, fol lowed by similarity
analysis using PCoA, indeed confirmed that the composition of the
microbial community was strongly affected by the type of diet which
was administered to the animals (Fig. 1B). A representative DGGE gel
for general bacteria is shown in supplemental data (SD 1).
3.2. ITF prebiotics lessen fat mass development driven by the HF diet
Energy intake was monitored twice a week during the treatment.
Total energy consumption, calculated upon diet's energy content and
prebiotic supplementation in water, tended to increase in HF-fed
mice and was not modified by ITF treatment (CT: 11.15, HF: 15.07, HF-
ITF: 13.79 kcal/day per mouse). Fat ingestion was strongly increased
in HF fed mice versus CT, and prebiotics did not modify this parameter
in a significant way (CT: 0.101; HF: 1.725; HF-ITF: 1.579 g fat/day per
mouse). Moreover, ITF prebiotics blunted the HF diet-induced body
weight gain (CT: 2.29±0.21; HF: 8.08±0.86; HF-ITF: 4.57±0.55 g)
and subcutaneous adipose tissue accumulation (Fig. 2A), despite the
similar fat ingestion.
3.3. ITF prebiotics increase basal lipolysis and improve adipose tissue
insulin response
Mean adipocyte size in SAT was significantly increased in HF-fed mice
versus CT, whereas ITF treatm ent normalized this param eter (Fig. 2B and
2C). In this tissue, basal lipolysis — estimated through the release of free
fatty acids in the medium — was decreased by the HF diet and restored by
the supplementation with ITF (Fig. 2D). Similar results were obtained
when glycerol was measured in the culture medium as an index of
lipolysis (data not shown). Moreover, lipolysis inhibition by insulin was
lower in explants of SAT from HF-fed mice in comparison to explants from
CT mice and ITF restored insulin effect to the level of CT group (Fig. 2D).
The insulin-induce d Akt phosphorylation, which reflec ts the response to
insulin, tended to decrease in explants of SAT of HF-fed mice versus CT
animals and was partially restored in ITF-treated mice (Fig. 2E). In
accordance with this result, the HF diet-induced an important increase of
insulin resistance index (HOMA) val ue and this was counterac ted by the
addition of ITF (Fig. 2F).
Fig. 2. Metabolic and histological analysis of subcutaneous adipose tissue in mice fed a CT diet, an HF diet or an HF-ITF diet after 4 weeks of treatment. (A) Subcutaneous adipose tissue
mass. (B) Mean adipocytes size. (C) Histological pictures in hematoxylin and eosin stain (bar=100 μm). (D) Free fatty acids (FFA) released by explants of SAT after 2 h of incubation
with or without insulin. (E) Percent of insulin-induced Akt phosphorylation reported to CT group. (F) Homeostasis model assessment. Data are mean±S.E.M. Data with different
superscript letters are significantly different at Pb.05, according to the post hoc ANOVA statistical analysis. The Two-way ANOVA analysis of Panel D shows a significant effect of insulin
and treatment (Pb.05); ⁎Pb.05 “basal lipolysis” versus “insulin-inhibited lipolysis” according to Bonferroni posttest.
5E.M. Dewulf et al. / Journal of Nutritional Biochemistry xx (2010) xxx–xxx
