scispace - formally typeset

Journal ArticleDOI

Conserved motifs in the invertebrate iridescent virus 6 (IIV6) genome regulate virus transcription.

01 Nov 2020-Journal of Invertebrate Pathology (Academic Press)-Vol. 177, pp 107496

TL;DR: The transcriptional class of all IIV6 genes that had not been classified until now is investigated and single nucleotide mutations in the highly conserved nucleotides at the end of the second motif showed that this motif acted as a repressor sequence for late genes in the IIV 6 genome.

AbstractInvertebrate iridescent virus 6 (IIV6) is the type species of the Iridovirus genus in the Betairidovirinae subfamily of the Iridoviridae family. Transcription of the 215 predicted IIV6 genes is temporally regulated, dividing the genes into three kinetic classes: immediate-early (IE), delayed-early (DE), and late (L). So far, the transcriptional class has been determined for a selection of virion protein genes and only for three genes the potential promoter regions have been analyzed in detail. In this study, we investigated the transcriptional class of all IIV6 genes that had not been classified until now. RT-PCR analysis of total RNA isolated from virus-infected insect cells in the presence or absence of protein and DNA synthesis inhibitors, placed 113, 23 and 22 of the newly analyzed viral ORFs into the IE, DE and L gene classes, respectively. Afterwards, in silico analysis was performed to the upstream regions (200 bp) of all viral ORFs using the MEME Suite Software. The AA(A/T)(T/A)TG(A/G)A and (T/A/C)(T/G/C)T(T/A)ATGG motifs were identified in the upstream region of IE and DE genes, respectively. These motifs were validated by luciferase reporter assays as crucial sequences for promoter activity. For the L genes two conserved motifs were identified for all analyzed genes: (T/G)(C/T)(A/C)A(T/G/C)(T/C)T(T/C) and (C/G/T)(G/A/C)(T/A)(T/G) (G/T)(T/C). However, the presence of these two motifs did not influence promoter activity. Conversely, the presence of these two sequences upstream of the reporter decreased its expression. Single nucleotide mutations in the highly conserved nucleotides at the end of the second motif (TTGT) showed that this motif acted as a repressor sequence for late genes in the IIV6 genome. Next, upstream sequences of IIV6 L genes from which we removed this second motif in silico, were re-analyzed for the presence of potential conserved promoter sequences. Two additional motifs were identified in this way for L genes: (T/A)(A/T)(A/T/G)(A/T)(T/C)(A/G)(A/C)(A/C) and (C/G)(T/C)(T/A/C)C(A/T)(A/T)T(T/G) (T/G)(T/G/A). Independent mutations in either motif caused a severe decrease in luciferase expression. Information on temporal classes and upstream regulatory sequences will contribute to our understanding of the transcriptional mechanisms in IIV6.

Summary (3 min read)

1. Introduction

  • Invertebrate iridescent viruses (IIVs, family Iridoviridae, subfamily Betairidovirinae, genus Iridovirus) form icosahedral particles of 120–180 nm in diameter (Chinchar et al., 2017).
  • Invertebrate iridescent virus 6 (IIV-6), also known as Chilo iridescent virus (CIV), is the type species of the Iridovirus genus.
  • These promoters have been identified by means of a luciferase reporter assay in conjunction with deletion mutagenesis of the sequences in the 5′upstream region of the respective ORFs.
  • In the current study, the authors investigated the transcriptional class of all as of yet unclassified IIV6 ORFs (170 transcripts) to complete the temporal classification and to be able to search for essential, conserved promoter motifs in IIV6 genes.

2.1. Cell line, virus and virus infections

  • Invertebrate iridescent virus 6 (IIV6) was propagated in these cells and the virus titer was determined in End Point Dilution Assays (Cook et al., 1976).
  • Virus infections were carried out with 2x106 Sf9 cells in 6-well plates, infected at a multiplicity of infection (MOI) of 2.
  • For the temporal classification of the genes, cultures were pre-treated 1 h before infection with cytosine-1-β-D-arabinofuranoside (Ara-C, 100 µg/ml) and cycloheximide (CHX, 150 µg/ml) to inhibit DNA and protein synthesis, respectively.
  • The inhibitors remained present during the infection.

2.2. Reverse transcription PCR (RT-PCR)

  • To determine the temporal expression classes of IIV6 genes, RNA isolated as described below was subjected to RT–PCR.
  • Total RNA was isolated from infected and mock-infected Sf9 cells at 12 h post infection (p.i.) using Trizol Reagent (Sigma, T9424) following the manufacturer’s instructions.
  • Isolated RNA samples were treated with DNase I (Sigma, AMPD1-1KT) to remove any residual DNA and then extracted with phenol–chloroform.
  • And the resulting cDNA mixture was then used as template for gene specific PCR amplifications with forward and reverse primers.
  • PCR performed with cDNA, obtained from infected cells in absence of inhibitors, was used as positive control (PC).

2.3. Conserved sequence analyses

  • MEME (multiple expectation maximization for motif elicitation) (Bailey et al., 2009) software was used to search for conserved sequences in IIV6 noncoding sequences in the 200 nt regions upstream of the translation initiation codons.
  • To that aim, the upstream sequences were categorized based on experimental data (IE, DE or L) to be able to compare upstream sequences within each expression class.
  • Parameters were set to zero or one occurrence per sequence and the authors searched only the provided strand.

2.4. Plasmid construction

  • Upstream sequences of selected genes from each temporal group were investigated to determine whether conserved motifs, found with the MEME software, are indeed important for promoter activity.
  • One gene was selected from each of the three groups.
  • Upstream regions of these genes were tested for promoter activity in combination with a luciferase reporter system.
  • Subsequently, upstream sequences of two additional L genes, 061R and 084L were also investigated with this system.
  • These DNA fragments were amplified from the viral genome using two different forward primers and a common reverse primer, for each gene (Table 1).

2.5. Transfection and luciferase assay

  • Sf9 cells (2.5 × 106 cells/well) in 6-well plates were infected with IIV6 for 2 h and then transfected using Cellfectin with plasmid DNA (1 µg) harboring the upstream sequences.
  • The various putative promoter constructs were tested in parallel.
  • Firefly luciferase activities were measured in cell extracts using the single luciferase reporter assay system following the manufacturer’s instructions.
  • Transfections were conducted in triplicate, and average values are reported.

2.6. Site directed mutagenesis

  • Highly conserved sequences, found in the upstream regions of the L gene 061R were mutated to understand the role of these sequences in determining promoter activity.
  • Mutations were performed by PCR using primers specific for the upstream region of 061R, but carrying a number of mismatched nucleotides (Table 1) (Nalcacioglu et al., 2003).
  • Amplified sequences were first cloned into the pJET1.2/blunt cloning vector and then transferred to the pSPLuc + vector, as described above.

3.1. Transcriptional classification of all IIV6 transcripts

  • The other 45 genes in the IIV6 genome have previously been classified A. Yesilyurt et al.
  • In order to classify the IIV6 genes, Sf9 cells were infected with IIV6 in the presence or absence of cycloheximide, which inhibits de novo polypeptide synthesis, and Ara-C, an inhibitor of DNA replication.
  • In infected cells, a total of 113 newly analyzed transcripts was detected in the presence of protein or DNA synthesis inhibitors, which means that viral protein synthesis and DNA replication are not necessary for these transcripts and therefore they are classified in the IE class (Fig. 1).
  • The number of the late transcripts among the 170 newly tested ORFs was 22 (Fig. 2B).
  • With the previously classified IIV6 genes, the total number of IE, DE and L genes became 138, 35 and 30, respectively.

4. Conserved motifs in the upstream region of IIV6 genes

  • After grouping the genes in the three temporal classes, sequences upstream of the translational start codon of each gene were investigated for the presence of conserved and potentially important motifs for promoter activity.
  • For each classified group of genes, motifs were generated by the MEME Suite database (Fig. 3).
  • The AA(A/T)(T/A)TG(A/G)A and (T/A/C)(T/G/C)T(T/A) ATGG sequences were identified with high probability as conserved motifs in the upstream regions of IE and DE genes, respectively (Fig. 3A-B).
  • For the 35 scanned DE genes, the motif obtained was only observed in 20 genes.
  • The locations of all these upstream motifs respective to the translation start site varies for each gene.

4.1. Investigating the motifs for promoter activity

  • To analyze the influence of the conserved motifs on promoter activity, deletion mutagenesis was performed on the upstream regions of 193R, 126R and 259R ORFs, belonging to the IE, DE and L classes, respectively.
  • Two fragments, one containing the motif and the other not, were prepared for each ORF.
  • Reporter plasmids harboring the wild type (wt) or mutant sequence upstream of a firefly luciferase reporter ORF, were transfected into Sf9 cells.
  • For L genes, the result was opposite.
  • The plasmids containing both the L1 and L2 motifs produced a low luciferase activity (pSP259Rprom, pSP084Lprom, pSP061Rprom), but the plasmids without these two motifs (pSP259RdelL1 + L2, pSP084LdelL1 + L2, pSP061RdelL1 + L2) produced a high activity.

4.2. Site-directed mutations in conserved late gene motifs

  • Reporter plasmids were prepared carrying both L1 and L2 motifs, but one unmutated sequence and the other mutated, to determine the impact of such changes on promoter activity.
  • Mutation of motif L1 (mutation 1) did not affect the promoter activity, however mutation at motif L2 (mutation 2) increased promoter activity.
  • The fact that the detected L motifs do not act as promoters led us to search for other conserved sequences that might have promoter activity.
  • KpnI and HindIII are shown in italicized and underlined.
  • Therefore, upstream sequences of all IIV6 L genes, from which the L1 and L2 motifs were in silico removed, were re-analyzed for the presence of potential promoter sequences using MEME Suite Software, resulting in two additional conserved sequences (motif L3 and motif L4) (Fig. 5).

5. Discussion

  • This study presents extensive information on the transcriptional regulation of invertebrate iridescent virus 6 (IIV6) genes.
  • Other transcriptional studies on IIV6 genes included temporal classification of a few genes: DNA polymerase (037L), major capsid protein (274L), A. Yesilyurt et al.
  • This result was therefore not conforming the defined temporal groups.

Did you find this useful? Give us your feedback

...read more

Content maybe subject to copyright    Report

Conserved motifs in the invertebrate iridescent virus 6 (IIV6) genome regulate
virus transcription
Journal of Invertebrate Pathology
Yesilyurt, Aydin; Demirbag, Zihni; Oers, Monique M.; Nalcacioglu, Remziye
https://doi.org/10.1016/j.jip.2020.107496
This article is made publicly available in the institutional repository of Wageningen University and Research, under the
terms of article 25fa of the Dutch Copyright Act, also known as the Amendment Taverne. This has been done with explicit
consent by the author.
Article 25fa states that the author of a short scientific work funded either wholly or partially by Dutch public funds is
entitled to make that work publicly available for no consideration following a reasonable period of time after the work was
first published, provided that clear reference is made to the source of the first publication of the work.
This publication is distributed under The Association of Universities in the Netherlands (VSNU) 'Article 25fa
implementation' project. In this project research outputs of researchers employed by Dutch Universities that comply with the
legal requirements of Article 25fa of the Dutch Copyright Act are distributed online and free of cost or other barriers in
institutional repositories. Research outputs are distributed six months after their first online publication in the original
published version and with proper attribution to the source of the original publication.
You are permitted to download and use the publication for personal purposes. All rights remain with the author(s) and / or
copyright owner(s) of this work. Any use of the publication or parts of it other than authorised under article 25fa of the
Dutch Copyright act is prohibited. Wageningen University & Research and the author(s) of this publication shall not be
held responsible or liable for any damages resulting from your (re)use of this publication.
For questions regarding the public availability of this article please contact openscience.library@wur.nl

Journal of Invertebrate Pathology 177 (2020) 107496
Available online 28 October 2020
0022-2011/© 2020 Elsevier Inc. All rights reserved.
Conserved motifs in the invertebrate iridescent virus 6 (IIV6) genome
regulate virus transcription
Aydin Yesilyurt
a
,
b
, Zihni Demirbag
a
, Monique M. van Oers
b
, Remziye Nalcacioglu
a
,
*
a
Department of Biology, Faculty of Science, Karadeniz Technical University, 61080 Trabzon, Turkey
b
Laboratory of Virology, Wageningen University and Research, 6708 PB Wageningen, the Netherlands
ARTICLE INFO
Keywords:
Transcriptional analysis
Promoter sequence
Repressor
Iridovirus
ABSTRACT
Invertebrate iridescent virus 6 (IIV6) is the type species of the Iridovirus genus in the Betairidovirinae subfamily of
the Iridoviridae family. Transcription of the 215 predicted IIV6 genes is temporally regulated, dividing the genes
into three kinetic classes: immediate-early (IE), delayed-early (DE), and late (L). So far, the transcriptional class
has been determined for a selection of virion protein genes and only for three genes the potential promoter
regions have been analyzed in detail. In this study, we investigated the transcriptional class of all IIV6 genes that
had not been classied until now. RT-PCR analysis of total RNA isolated from virus-infected insect cells in the
presence or absence of protein and DNA synthesis inhibitors, placed 113, 23 and 22 of the newly analyzed viral
ORFs into the IE, DE and L gene classes, respectively. Afterwards, in silico analysis was performed to the upstream
regions (200 bp) of all viral ORFs using the MEME Suite Software. The AA(A/T)(T/A)TG(A/G)A and (T/A/C)(T/
G/C)T(T/A)ATGG motifs were identied in the upstream region of IE and DE genes, respectively. These motifs
were validated by luciferase reporter assays as crucial sequences for promoter activity. For the L genes two
conserved motifs were identied for all analyzed genes: (T/G)(C/T)(A/C)A(T/G/C)(T/C)T(T/C) and (C/G/T)(G/
A/C)(T/A)(T/G) (G/T)(T/C). However, the presence of these two motifs did not inuence promoter activity.
Conversely, the presence of these two sequences upstream of the reporter decreased its expression. Single
nucleotide mutations in the highly conserved nucleotides at the end of the second motif (TTGT) showed that this
motif acted as a repressor sequence for late genes in the IIV6 genome. Next, upstream sequences of IIV6 L genes
from which we removed this second motif in silico, were re-analyzed for the presence of potential conserved
promoter sequences. Two additional motifs were identied in this way for L genes: (T/A)(A/T)(A/T/G)(A/T)(T/
C)(A/G)(A/C)(A/C) and (C/G)(T/C)(T/A/C)C(A/T)(A/T)T(T/G) (T/G)(T/G/A). Independent mutations in either
motif caused a severe decrease in luciferase expression. Information on temporal classes and upstream regulatory
sequences will contribute to our understanding of the transcriptional mechanisms in IIV6.
1. Introduction
Invertebrate iridescent viruses (IIVs, family Iridoviridae, subfamily
Betairidovirinae, genus Iridovirus) form icosahedral particles of
120180 nm in diameter (Chinchar et al., 2017). Virions comprise a
DNA/protein core surrounded by an internal lipid membrane, a protein
capsid and in the case of those particles that bud out of cells, an outer
viral envelope. IIVs have been reported to infect over 100 species of
arthropods (Williams et al., 2017). Invertebrate iridescent virus 6 (IIV-6),
also known as Chilo iridescent virus (CIV), is the type species of the
Iridovirus genus. The IIV6 genome consists of 212,482 bp of linear
dsDNA (Jakob and Darai, 2002) with 215 non-overlapping and putative
protein-encoding ORFs selected from the 468 computationally predicted
ORFs (Eaton et al., 2007). Proteomic analysis has shown that IIV6 par-
ticles contain 54 structural, viral-encoded proteins (Ince et al., 2010).
The replication of the IIV6 genome is presumed to be essentially similar
to that of Frog virus 3 (FV3), the type species of the genus Ranavirus, in
the subfamily Alphairidovirinae (Granoff, 1984; Williams and Ward,
2010). Viral genome replication starts in the nucleus and is followed by
genome concatamerization and subsequent cleavage, particle assembly
and maturation in the cytoplasm (Goorha, 1982). Since puried IIV6
DNA is not infectious, one or more virion-associated proteins are needed
for the initiation of IIV gene transcription (Cerutti et al., 1989).
A previous study on IIV6 mRNAs detectable by northern blot analysis
revealed three temporal transcript classes in IIV6 infections: immediate-
early (IE), delayed-early (DE) and late (L) (DCosta et al., 2001). Thirty
* Corresponding author.
Contents lists available at ScienceDirect
Journal of Invertebrate Pathology
journal homepage: www.elsevier.com/locate/jip
https://doi.org/10.1016/j.jip.2020.107496
Received 3 September 2020; Received in revised form 14 October 2020; Accepted 20 October 2020

Journal of Invertebrate Pathology 177 (2020) 107496
2
eight of the detected transcripts were synthesized in the presence of
protein synthesis inhibitors and were classied in the IE class; thirty four
transcripts were produced in the presence of DNA synthesis inhibitors
and were classied in the DE class, while 65 ve transcripts were
detected only in the absence of inhibitors and were classied in the L
class. However, as the transcripts were classied prior to genome
sequencing, the relationship between the ORFs and their temporal
classication was not previously established. In a later study, the 54 IIV6
structural virion protein genes were analyzed for their temporal
expression, showing that the majority of these were expressed as IE
genes (Ince et al., 2013).
It is known that IIV6 transcripts possess generally short 5
untrans-
lated regions and lack poly A tails (Nalcacioglu et al., 2003). On the
other hand, information regarding the promoter elements of IIV6 genes
is rather limited. So far, potential promoter regions of only three IIV6
genes, exonuclease (012L, IE), DNApol (037L, DE) and major capsid pro-
tein gene (mcp) (274L, L), have been characterized in detail (Nalcacioglu
et al., 2003; 2007; Dizman et al., 2012). These promoters have been
identied by means of a luciferase reporter assay in conjunction with
deletion mutagenesis of the sequences in the 5
upstream region of the
respective ORFs. In the current study, we investigated the transcrip-
tional class of all as of yet unclassied IIV6 ORFs (170 transcripts) to
complete the temporal classication and to be able to search for
essential, conserved promoter motifs in IIV6 genes. Therefore, the up-
stream regions of all genes in a particular class (classied in this paper
and in previous studies) were compared and analyzed for conserved
sequence motifs. The identied conserved sequences were examined for
promoter activity in insect cells using the luciferase reporter assay.
2. Material and methods
2.1. Cell line, virus and virus infections
Spodoptera frugiperda 9 (Sf9) cells were maintained in Sf-900 II SFM
(Gibco) supplemented with 5% fetal bovine serum (FBS, Sigma) at 28
C
as monolayer. Invertebrate iridescent virus 6 (IIV6) was propagated in
these cells and the virus titer was determined in End Point Dilution
Assays (EPDAs) (Cook et al., 1976). Virus infections were carried out
with 2x10
6
Sf9 cells in 6-well plates, infected at a multiplicity of infec-
tion (MOI) of 2. For the temporal classication of the genes, cultures
were pre-treated 1 h before infection with cytosine-1-β-
D-arabinofur-
anoside (Ara-C, 100 µg/ml) and cycloheximide (CHX, 150 µg/ml) to
inhibit DNA and protein synthesis, respectively. The inhibitors remained
present during the infection.
2.2. Reverse transcription PCR (RT-PCR)
To determine the temporal expression classes of IIV6 genes, RNA
isolated as described below was subjected to RTPCR. Forward and
reverse gene specic primers were designed to amplify suitable regions
from all viral genes (Table S1). Total RNA was isolated from infected and
mock-infected Sf9 cells at 12 h post infection (p.i.) using Trizol Reagent
(Sigma, T9424) following the manufacturers instructions. Isolated RNA
samples were treated with DNase I (Sigma, AMPD1-1KT) to remove any
residual DNA and then extracted with phenolchloroform. For cDNA
synthesis, 1 µg of total RNA was mixed with 1 µl (10 µM) gene specic
reverse primer and the total volume was adjusted to 12 µl with water.
After incubation at 65
C for 5 min, the samples were cooled on ice.
Subsequently, 4 µl reaction buffer (5X), 1 µl RiboLock RNase inhibitor
(20
μ
/µl), 2 µl dNTP mix (10 mM) and 1 µl reverse transcriptase (Thermo
Scientic, RevertAid M MuLV RT, 200 u/µl) were gently mixed in and
reactions were incubated at 42
C for 60 min. The cDNA synthesis was
terminated by heating at 70
C for 5 min. and the resulting cDNA
mixture was then used as template for gene specic PCR amplications
with forward and reverse primers. PCR products were analyzed in a 1%
agarose gel stained with ethidium bromide. PCR performed with cDNA,
obtained from infected cells in absence of inhibitors, was used as posi-
tive control (PC).
2.3. Conserved sequence analyses
MEME (multiple expectation maximization for motif elicitation)
(Bailey et al., 2009) software was used to search for conserved sequences
in IIV6 noncoding sequences in the 200 nt regions upstream of the
translation initiation codons. To that aim, the upstream sequences were
categorized based on experimental data (IE, DE or L) to be able to
compare upstream sequences within each expression class. Parameters
were set to zero or one occurrence per sequence and we searched only
the provided (coding) strand.
2.4. Plasmid construction
Upstream sequences of selected genes from each temporal group
were investigated to determine whether conserved motifs, found with
the MEME software, are indeed important for promoter activity. One
gene was selected from each of the three groups. 193R, 126R and 259R
were selected as models for IE, DE and L class genes, respectively. Up-
stream regions of these genes were tested for promoter activity in
combination with a luciferase reporter system. Subsequently, upstream
sequences of two additional L genes, 061R and 084L were also investi-
gated with this system. Two different regions were amplied from each
upstream region; one is the long one containing the conserved motif (wt)
and the other is the short one missing the motif (del for E and DE or delL1
+ L2 in case of L genes). These DNA fragments were amplied from the
viral genome using two different forward primers and a common reverse
primer, for each gene (Table 1). The resulting PCR products, containing
KpnI and HindIII sites at 5
and 3
ends, respectively, were ligated into
the pJET1.2/blunt cloning vector (Thermo). Subsequently these frag-
ments were cloned into upstream of the luciferase reporter ORF of the
pSPLuc + vector (Promega), again using the restriction sites at the ends
of the fragments.
2.5. Transfection and luciferase assay
Sf9 cells (2.5 × 10
6
cells/well) in 6-well plates were infected with
IIV6 for 2 h and then transfected using Cellfectin (Invitrogen) with
plasmid DNA (1 µg) harboring the upstream sequences. The various
putative promoter constructs were tested in parallel. At 24 h after
transfection, cells were collected by centrifugation at 1000g for 5 min.
Firey luciferase activities were measured in cell extracts using the
single luciferase reporter assay system (Promega) following the manu-
facturers instructions. Transfections were conducted in triplicate, and
average values are reported.
2.6. Site directed mutagenesis
Highly conserved sequences, found in the upstream regions of the L
gene 061R were mutated to understand the role of these sequences in
determining promoter activity. Mutations were performed by PCR using
primers specic for the upstream region of 061R, but carrying a number
of mismatched nucleotides (Table 1) (Nalcacioglu et al., 2003). Ampli-
ed sequences were rst cloned into the pJET1.2/blunt cloning vector
and then transferred to the pSPLuc + vector, as described above.
3. Results
3.1. Transcriptional classication of all IIV6 transcripts
To be able to categorize the whole set of genes in the IIV6 genome
according to their transcriptional classes, we examined the expression of
170 IIV6 genes at the transcriptional level by RT-PCR. The other 45
genes in the IIV6 genome have previously been classied
A. Yesilyurt et al.

Journal of Invertebrate Pathology 177 (2020) 107496
3
transcriptionally (Nalcacioglu et al., 2007; Ince et al., 2008; 2013;
Dizman et al., 2012) and were not examined again, except for 012L (IE),
037L (DE) and 274L (L) that were used as positive controls in the current
study. In order to classify the IIV6 genes, Sf9 cells were infected with
IIV6 in the presence or absence of cycloheximide, which inhibits de novo
polypeptide synthesis, and Ara-C, an inhibitor of DNA replication. Total
cellular RNA was extracted from cells at 12 h p.i. and analyzed for the
presence of IIV6 transcripts using gene specic primers. In infected cells,
a total of 113 newly analyzed transcripts was detected in the presence of
protein or DNA synthesis inhibitors, which means that viral protein
synthesis and DNA replication are not necessary for these transcripts and
therefore they are classied in the IE class (Fig. 1). The number of the
additional transcripts detected in the presence of only the DNA synthesis
inhibitor was 23 (Fig. 2A). Since these transcripts do not require viral
DNA replication but require viral protein synthesis to be transcribed,
they were classied in the DE class, and indeed the DE-positive control
(037L) was also detected here. The other transcripts that were not
detected in the presence of either inhibitors, were classied in the L
class. The number of the late transcripts among the 170 newly tested
ORFs was 22 (Fig. 2B). However, no RT-PCR products were obtained
from the putative transcripts of 12 ORFs (069L, 121R, 146R, 148R,
201R, 212L, 236L, 238R, 315L, 414L, 426R, 463L). With the previously
classied IIV6 genes, the total number of IE, DE and L genes became 138,
35 and 30, respectively.
Among the 138 IE genes identied in total, 61 have a known or a
putative function according to gene ontology information obtained from
the UniProt database. Eight of the 35 DE transcripts, have an identied
or a predicted function. The remaining 27 transcripts of the DE class do
not contain a known domain to predict their function (Table 2). The
third set of transcripts, classied as L, includes 7 genes with a known or
putative function and 23 genes of unknown function (Table 2).
4. Conserved motifs in the upstream region of IIV6 genes
After grouping the genes in the three temporal classes, sequences
upstream of the translational start codon of each gene were investigated
for the presence of conserved and potentially important motifs for pro-
moter activity. For each classied group of genes, motifs were generated
by the MEME Suite database (Fig. 3). The AA(A/T)(T/A)TG(A/G)A and
(T/A/C)(T/G/C)T(T/A) ATGG sequences were identied with high
probability as conserved motifs in the upstream regions of IE and DE
genes, respectively (Fig. 3A-B). The program run for the upstream se-
quences of the 138 IE genes identied the conserved motif in all of these
genes. However, for the 35 scanned DE genes, the motif obtained was
only observed in 20 genes. For late genes the program detected two
conserved motifs, (T/G)(C/T)(A/C)A(T/G/C)(T/C)T(T/C) (motif L1)
and (C/G/T)(G/A/C)(T/A)(T/G)(G/T)(T/C) (motif L2), with a similar
and high probability in the upstream regions of all scanned late genes
(Fig. 3C-D). The locations of all these upstream motifs respective to the
translation start site varies for each gene.
4.1. Investigating the motifs for promoter activity
To analyze the inuence of the conserved motifs on promoter ac-
tivity, deletion mutagenesis was performed on the upstream regions of
193R, 126R and 259R ORFs, belonging to the IE, DE and L classes,
respectively. Two fragments, one containing the motif and the other not,
were prepared for each ORF. Reporter plasmids harboring the wild type
(wt) or mutant sequence upstream of a rey luciferase reporter ORF,
were transfected into Sf9 cells. Cell lysates, obtained 24 h after trans-
fection, were tested for luciferase activity.
The reporter plasmids that carried the wild type (wt) upstream re-
gions for IE or DE genes (pSP193Rprom, pSP126Rprom), produced high
luciferase activity, but the plasmids without the motif (pSP193Rdel,
pSP126Rdel) produced a low activity (Fig. 4A-B). However, for L genes,
the result was opposite. The plasmids containing both the L1 and L2
motifs produced a low luciferase activity (pSP259Rprom,
pSP084Lprom, pSP061Rprom), but the plasmids without these two
motifs (pSP259RdelL1 + L2, pSP084LdelL1 + L2, pSP061RdelL1 + L2)
produced a high activity. This result was validated with two additional
late genes (061L, 084L) by preparing similar deletion mutations and
testing the luciferase activity as mentioned above (Fig. 4C).
4.2. Site-directed mutations in conserved late gene motifs
To analyze these L motifs in more detail, we modied the L1 and L2
motifs in the upstream region of 061R individually by PCR using primers
with mismatches. Reporter plasmids were prepared carrying both L1
and L2 motifs, but one unmutated sequence and the other mutated, to
determine the impact of such changes on promoter activity. Mutation of
motif L1 (mutation 1) did not affect the promoter activity, however
mutation at motif L2 (mutation 2) increased promoter activity. This
result demonstrates that motif L2 acts as a repressor on L gene promoter
activity by a factor of over 90% (Fig. 5). The fact that expression levels
were not fully restored to high levels by deleting L2, suggest that L1 is
insufcient for a fully-functional promoter sequence.
The fact that the detected L motifs do not act as promoters led us to
search for other conserved sequences that might have promoter activity.
Table 1
Primers for the promotor analyses.
Primers Tm (
C) Primer sequences (5- 3)
193R-prom-Fw 46.4 GGTACCGAGGATTTAAAAAAGTTTTAATTTAAA
193R-del-Fw 46.4 GGTACCTTCAAAATTAATAATACATGATACAAT
193R-prom-Rv 48.1 AAGCTTATTATAAATTCCACATGTATCCAT
126R-prom-Fw 50.1 GGTACCGGTTTTATAAAACAATTAGCACAATTT
126R-del-Fw 45.2 GGTACCGATAACCATTAAAAATTATAAATAATTG
126R- prom-Rv 47.4 AAGCTTTTCTAAATTTGAAAATAAACTTCTTAC
259R-prom-Fw 50.4 GGTACCGGTATTTTCGTAATTCATTTCTTGAT
259R-del-Fw 50.8 GGTACCGGATTGATGCTTTTAAATGAAAAATATG
259R- prom-Rv 51.7 AAGCTTTGTATTTATCACTAATTCGTGTTTTGT
084L- prom-Fw 50.5 GGTACCTAAAGTTTCAATTTTGGAAGTTCG
084L-del-Fw 50.5 GGTACCAACTAATGGAAGAAGACTTTCAG
084L- prom-Rv 49.5 AAGCTTAGGAGACATTCTTTTATTTACAATTAA
061R- prom-Fw 46.9 GGTACCCATCATTTTTTCACTTTCATTTAA
061R-del-Fw 45.9 GGTACCGTAATATTTCTTTAATACTGAAAAATC
061R- prom-Rv 46.9 AAGCTTAATTCCTACGCAAATAATTATAC
061R-mutL1-Fw 63.5 GGTACCCATCATTGGAGTGAGCGTCTTTAATAGTGGAGATTTATTTTTAGACATATCTTGTTTATTTTTA
061R-mutL2-Fw 62.4 GGTACCCATCATTTTTTCACTTTCATTTAATAGTGGAGATTTATTTTTAGACATATCGCAGTTATTTTTA
061R-mutL3-Fw 60.1 GGTACCACTGTTCCGACGACGTTGATATTAAACACTACTAT
061R-mutL4-Fw 58.7 GGTACCACTGAAAAATCAAAGTTGATATGCCTCTGTTGTAT
KpnI (GGTACC) and HindIII (AAGCTT) are shown in italicized and underlined.
A. Yesilyurt et al.

Journal of Invertebrate Pathology 177 (2020) 107496
4
Therefore, upstream sequences of all IIV6 L genes, from which the L1
and L2 motifs were in silico removed, were re-analyzed for the presence
of potential promoter sequences using MEME Suite Software, resulting
in two additional conserved sequences (motif L3 and motif L4) (Fig. 5).
These motifs were individually mutated in PCR fragments that did not
contain the L1 and L2 motifs and reporter analysis clearly showed that
both motifs L3 and L4 contributed to L promoter activity (Fig. 5).
5. Discussion
This study presents extensive information on the transcriptional
regulation of invertebrate iridescent virus 6 (IIV6) genes.
Transcriptional studies on iridovirids (members of the family Iridovir-
idae) have been reported previously for Frog virus 3 (Majji et al., 2009),
Singapore grouper iridovirus (Chen et al., 2006; Teng et al., 2008), Red
sea bream iridovirus (Lua et al., 2005; Dang et al., 2007; 2008), IIV6
(DCosta et al., 2001, 2004; Ince et al., 2008; 2013; Nalcacioglu et al.,
2003; Dizman et al., 2012) and IIV9 (McMillan and Kalmakoff, 1994).
The rst transcriptional study on IIV6 genes identied 137 transcripts of
which 38 corresponded to IE, 34 in DE and 65 in L temporal classes
based on northern blot analysis. However, these authors did not clearly
identify the ORFs in their study (DCosta et al., 2004). Other tran-
scriptional studies on IIV6 genes included temporal classication of a
few genes: DNA polymerase (037L), major capsid protein (274L),
Fig. 1. Immediate-early (IE) gene transcripts of IIV6. Cells were infected with IIV6 in the presence of DNA (Ara-C) or protein synthesis (CHX) inhibitors. ORF-specic
RT-PCR was carried out on total RNA isolated at 12 h post infection. Genes that give a positive RT-PCR signal in the presence of these inhibitors are categorized as IE
genes. ORF: open reading frame; Ara-C: DNA synthesis inhibitor (cytosine arabinoside); CHX: protein synthesis inhibitor (cycloheximide). PC: Positive control,
infection without addition of inhibitors.
A. Yesilyurt et al.

Figures (6)
References
More filters

Journal ArticleDOI
TL;DR: The popular MEME motif discovery algorithm is now complemented by the GLAM2 algorithm which allows discovery of motifs containing gaps, and all of the motif-based tools are now implemented as web services via Opal.
Abstract: The MEME Suite web server provides a unified portal for online discovery and analysis of sequence motifs representing features such as DNA binding sites and protein interaction domains. The popular MEME motif discovery algorithm is now complemented by the GLAM2 algorithm which allows discovery of motifs containing gaps. Three sequence scanning algorithms—MAST, FIMO and GLAM2SCAN—allow scanning numerous DNA and protein sequence databases for motifs discovered by MEME and GLAM2. Transcription factor motifs (including those discovered using MEME) can be compared with motifs in many popular motif databases using the motif database scanning algorithm Tomtom. Transcription factor motifs can be further analyzed for putative function by association with Gene Ontology (GO) terms using the motif-GO term association tool GOMO. MEME output now contains sequence LOGOS for each discovered motif, as well as buttons to allow motifs to be conveniently submitted to the sequence and motif database scanning algorithms (MAST, FIMO and Tomtom), or to GOMO, for further analysis. GLAM2 output similarly contains buttons for further analysis using GLAM2SCAN and for rerunning GLAM2 with different parameters. All of the motif-based tools are now implemented as web services via Opal. Source code, binaries and a web server are freely available for noncommercial use at http://meme.nbcr.net.

6,070 citations


Journal ArticleDOI
TL;DR: The re-analysis of genomes within the Iridoviridae family provides a unifying framework to understand the biology of these viruses, and further re-defining the core set of iridovirus genes will continue to lead to a better understanding of the phylogenetic relationships between individual irids.
Abstract: Members of the family Iridoviridae can cause severe diseases resulting in significant economic and environmental losses. Very little is known about how iridoviruses cause disease in their host. In the present study, we describe the re-analysis of the Iridoviridae family of complex DNA viruses using a variety of comparative genomic tools to yield a greater consensus among the annotated sequences of its members. A series of genomic sequence comparisons were made among, and between the Ranavirus and Megalocytivirus genera in order to identify novel conserved ORFs. Of these two genera, the Megalocytivirus genomes required the greatest number of altered annotations. Prior to our re-analysis, the Megalocytivirus species orange-spotted grouper iridovirus and rock bream iridovirus shared 99% sequence identity, but only 82 out of 118 potential ORFs were annotated; in contrast, we predict that these species share an identical complement of genes. These annotation changes allowed the redefinition of the group of core genes shared by all iridoviruses. Seven new core genes were identified, bringing the total number to 26. Our re-analysis of genomes within the Iridoviridae family provides a unifying framework to understand the biology of these viruses. Further re-defining the core set of iridovirus genes will continue to lead us to a better understanding of the phylogenetic relationships between individual iridoviruses as well as giving us a much deeper understanding of iridovirus replication. In addition, this analysis will provide a better framework for characterizing and annotating currently unclassified iridoviruses.

149 citations


Journal ArticleDOI
20 May 2004-Virology
TL;DR: The complete nucleotide sequence of the FV3 genome is determined and a microsatellite containing a stretch of 34 tandemly repeated CA dinucleotide in a noncoding region was detected.
Abstract: Frog virus 3 (FV3) is the type species member of the genus Ranavirus (family Iridoviridae). To better understand the molecular mechanisms involved in the replication of FV3, including transcription of its highly methylated DNA genome, we have determined the complete nucleotide sequence of the FV3 genome. The FV3 genome is 105903 bp long excluding the terminal redundancy. The G + C content of FV3 genome is 55% and it encodes 98 nonoverlapping potential open reading frames (ORFs) containing 50-1293 amino acids. Eighty-four ORFs have significant homology to known proteins of other iridoviruses, whereas twelve of these unique FV3 proteins do not share homology to any known protein. A microsatellite containing a stretch of 34 tandemly repeated CA dinucleotide in a noncoding region was detected. To date, no such sequence has been reported in any animal virus.

129 citations


Journal ArticleDOI
TL;DR: Results of pulse-chase experiments showed that the concatemeric DNA served as the precursor for the production of mature FV3 DNA, suggesting that this mode of replication is strikingly different from any other known DNA virus.
Abstract: Viral DNA synthesis in frog virus 3 (FV3)-infected cells occurs both in the nucleus and in the cytoplasm (Goorha et al., Virology 84:32-51, 1978). Relationships between viral DNA molecules synthesized in these two compartments and their role in the virus replication were examined. The data presented here suggest that (i) FV3 DNA replicated in two stages and (ii) nucleus and cytoplasm were the sites of stages 1 and 2 of DNA replication, respectively. Stages 1 and 2 were further distinguished by their temporal appearance during infection and by the sizes of the replicating DNA as determined by sedimentation in neutral sucrose gradients. In stage 1, replicating molecules, between the size of unit and twice the unit length, were produced early in infection (2 h postinfection). In contrast, stage 2 of DNA replication occurred only after 3 h postinfection, and replicating molecules were large concatemers. Results of pulse-chase experiments showed that the concatemeric DNA served as the precursor for the production of mature FV3 DNA. Denaturation of concatemeric DNA with alkali or digestion with S1 nuclease reduced it to less than genome size molecules, indicating the presence of extensive single-stranded regions. Analysis of replicating DNA by equilibrium centrifugation in CsCl gradients after a pulse-chase suggested that these single-stranded regions were subsequently repaired. Based on these and previous data, a scheme of FV3 replication is presented. According to this scheme, FV3 utilizes the nucleus for early transcription and stage 1 of DNA replication. The viral DNA is then transported to the cytoplasm, where it participates in stage 2 DNA replication to form a concatemeric replication complex. The processing of concatemers to produce mature viral DNA and virus assembly also occurs in the cytoplasm. This mode of replication is strikingly different from any other known DNA virus.

94 citations


Journal ArticleDOI
TL;DR: The Iridoviridae is a family of large, icosahedral viruses with double-stranded DNA genomes ranging in size from 103 to 220 kbp, and in vertebrates they can lead to high levels of mortality among commercially and ecologically important fish and amphibians.
Abstract: The Iridoviridae is a family of large, icosahedral viruses with double-stranded DNA genomes ranging in size from 103 to 220 kbp. Members of the subfamily Alphairidovirinae infect ectothermic vertebrates (bony fish, amphibians and reptiles), whereas members of the subfamily Betairidovirinae mainly infect insects and crustaceans. Infections can be either covert or patent, and in vertebrates they can lead to high levels of mortality among commercially and ecologically important fish and amphibians. This is a summary of the current International Committee on Taxonomy of Viruses (ICTV) Report on the taxonomy of the Iridoviridae, which is available at www.ictv.global/report/iridoviridae.

89 citations


Frequently Asked Questions (1)
Q1. What are the contributions in "Conserved motifs in the invertebrate iridescent virus 6 (iiv6) genome regulate virus transcription" ?

In this study, the authors investigated the transcriptional class of all IIV6 genes that had not been classified until now. Conversely, the presence of these two sequences upstream of the reporter decreased its expression. Next, upstream sequences of IIV6 L genes from which the authors removed this second motif in silico, were re-analyzed for the presence of potential conserved promoter sequences.