ONCOLOGY LETTERS 13: 3951-3957, 2017
Abstract. Reverse transcription quantitative polymerase chain
reaction (RT-qPCR) has become a frequently used strategy in
gene expression studies. The relative quantication method is
an important and commonly used method for the evaluation
of RT-qPCR data. The key aim of this method is to identify
an applicable internal reference gene. However, there are
currently no data concerning the expression of reference genes
for gene analysis in human tongue carcinoma cell lines and
tissues. In the present study, screening was performed using
12 common reference genes, which were selected in order to
provide an experimental basis for the investigation of gene
expression in human tongue carcinoma. Tca-8113 and CAL-27
cell lines and a total of 8 tongue carcinoma tissue samples
were investigated. The gene expression stability and the appli-
cability of the 12 reference gene candidates were determined
using the geNorm, NormFinder and BestKeeper software
programs. The results from the three software programs
were demonstrated to be variable following comparison. The
recommended combinations were 5'-aminolevulinate synthase
1 + glucuronidase β + ribosomal protein L29 (RPL29) for the
cell line + tissue group, β-2-microglobulin + RPL29 for the
cell line group and peptidylprolyl isomerase A + hydroxy-
methylbilane synthase + RPL29 for the tissue group. These
recommended internal reference genes may improve the accu-
racy of relative quantitation analysis of target gene expression
performed by the RT-qPCR method in further gene expression
research on human tongue carcinoma.
Introduction
Reverse transcription quantitative polymerase chain reaction
(RT-qPCR) is frequently used in gene expression studies and
is currently considered the gold standard for accurate, sensi-
tive and rapid measurements of gene expression. Relative
quantication is an important and commonly used technique
to evaluate RT-qPCR data, during which the expression levels
of target genes are compared with those of a stably expressed
endogenous control gene, determined simultaneously in
the same biological sample. Therefore, the gene expression
levels require normalization using reference genes in order to
obtain reliable data. The identication of appropriate refer-
ence genes is a crucial stage involved in this approach. It is
important for the ideal reference genes to be universally valid
under the experimental conditions (1,2). In general, cellular
maintenance genes, including glyceraldehyde-3-phosphate
dehydrogenase (GAPDH), β-actin (ACTB) and ribosomal
RNA (18S rRNA), are selected as reference genes to examine
the variability between clinical samples. However, several
studies have demonstrated that the expression levels of these
commonly used reference genes vary in different tissues or
between treatments in the same tissue (3-6), as well as across
cell types (7-9).
Tongue carcinoma is the most common malignancy of
the oral cavity, accounting for 12.2% of all head and neck
cancers (10,11). Tongue cancer is characterized by a high
malignant degree, high local recurrence rate, high neck
metastasis rate and high rate of mortality. It is the focus of oral
tongue cancer surgery.
RT-qPCR is a frequently used technique to investigate
differential gene expression, thus a review of the normaliza-
tion standards used in quantitative gene expression studies
of human tongue carcinoma was deemed necessary. To the
best of our knowledge, no systematic study has previously
been performed on the selection of suitable reference genes
for investigating target gene proling between human tongue
carcinoma cell lines and tissues.
Validation of reference genes for the normalization of RT-qPCR
expression studies in human tongue carcinoma cell lines and tissue
XIAOFENG WANG
1
, XIN LIU
1
, CONG LIU
1
, MING REN
2
, SUJIE GAO
3
,
GUANJIE ZHAO
4
, TIANFU ZHANG
1
and QIWEI YANG
2,5
1
Stomatology Department, China-Japan Union Hospital, Jilin University, Changchun, Jilin 130033;
2
Institute of Orthopedics, Second Hospital, Jilin University, Changchun, Jilin 130041;
3
Anesthesiology
and
4
Nephrology Departments, China-Japan Union Hospital, Jilin University, Changchun, Jilin 130033;
5
Central Laboratory, Second Hospital, Jilin University, Changchun, Jilin 130041, P.R. China
Received December 15, 2015; Accepted February 3, 2017
DOI: 10.3892/ol.2017.5887
Correspondence to: Dr Qiwei Yang, Central Laboratory,
Second Hospital, Jilin University, 218 Ziqiang Street, Changchun,
Jilin 130041, P.R. China
E-mail: qiweiy@163.com
Dr Tianfu Zhang, Stomatology Department, China-Japan Union
Hospital, Jilin University, 126 Xiantai Street, Changchun,
Jilin 130033, P.R. China
E-mail: zhangtianfu1963@sina.com
Key words: reverse transcription quantitative polymerase chain
reaction, reference gene, human tongue carcinoma
WA NG et al: VALIDATION OF RGS IN HUMAN TONGUE CARCINOMA CELL LINES AND TISSUE
3952
The present study aimed to identify the most suit-
able reference gene or set of genes for target gene proling
of human tongue carcinoma. The stabilities of a panel of
12 common reference genes in human tongue carcinoma cell
lines and tissues were validated. The 12 candidate genes:
ACTB, 5'-aminolevulinate synthase 1 (ALAS1), GAPDH,
TATA-box binding protein (TBP), hypoxanthine phosphori-
bosyltransferase 1 (HPRT1), ribosomal protein L29 (RPL29),
hydroxymethylbilane synthase (HMBS), peptidylprolyl
isomerase A (PPIA), pumilio RNA binding family member 1
(PUM1), glucuronidase β (GUSB), β-2-microglobulin (B2M)
and 18S rRNA are frequently used as endogenous controls
in the context of tongue carcinoma, but are not restricted to
this. A number of these genes have been identied as optimal
reference genes in certain other cancer types, including
HPRT1 and ACTB (12,13). Three common software packages,
geNorm (14), NormFinder (15) and Bestkeeper (16), were
used to investigate these genes. The aim was to provide useful
information for the selection of suitable reference genes in
further gene expression studies on human tongue carcinoma.
Materials and methods
Human tongue carcinoma cell lines. The human tongue carci-
noma cell line Tca-8113 was provided by Jilin Cancer Hospital
(Changchun, China) and CAL-27 cells were provided by the
Hospital of Stomatology, Jilin University (Changchun, China).
Cells were cultivated in Iscove's modied Dulbecco's medium
(Gibco; Thermo Fisher Scientic, Inc., Waltham, MA, USA)
containing 10% fetal bovine serum (Gibco; Thermo Fisher
Scientic, Inc.) with 100 units of penicillin, maintained at
37˚C in a 5% CO
2
humidied atmosphere, according to the
recommendation of the supplier.
Tongue carcinoma tissue samples. A total of 8 tongue carci-
noma tissue samples were provided by the Tissue Bank of
China-Japan Union Hospital, Jilin University (Changchun,
China). The clinicopathological characteristics of the patients
were summarized in Table I. The present study was approved
by the Ethics Committee of the China-Japan Union Hospital,
Jilin University (Changchun, China).
RNA extraction and complementary DNA (cDNA) synthesis.
The cell lines were recovered from liquid nitrogen and
cultured for 72 h. A total of 50-100 mg tissue samples were
homogenized in 1 ml TRIzol reagent (Invitrogen; Thermo
Fisher Scientific, Inc.). Total RNA was extracted from the
cells and each tissue sample using TRIzol reagent following
the manufacturer's protocol. DNase I (Sangon Biotech Co.,
Ltd., Shanghai, China) was used to eliminate genomic DNA
contamination. The concentrations and purity of the isolated
RNA were measured by NanoDrop 2000 (Thermo Fisher
Scientic, Inc.).
The cDNA synthesis reaction was performed three times
using the M-MuLV First Strand cDNA Synthesis kit (Sangon
Biotech Co., Ltd., Shanghai, China) according to the manu-
facturer's protocol. The total reaction volume was 20 µl. Total
RNA (1 µg), 1 µl random primer and RNase free water were
mixed, incubated at 65˚C for 5 min and then cooled down
immediately on ice for 30 sec. The rest of the reaction reagents
were added, then the mixture was incubated at 42˚C for 60 min
and the reaction was terminated by heating at 70˚C for 10 min.
RT‑qPCR. The primers of 12 putative reference genes were
selected based on previous studies, and are widely used and
recognized to be good reference genes (18,19). The primers
were synthesized by Sangon Biotech Co., Ltd. and the
sequences are listed in Table II. A Roche LightCycler 480
detection system (Roche Diagnostics GmbH, Mannheim,
Germany) was used for RT-qPCR. Reactions were performed
using 2xSG Fast qPCR Master Mix (Sangon Biotech Co., Ltd.)
according to the manufacturer's protocol. All the samples were
run in triplicate. The PCR volume was 20 µl, containing 2 µl
cDNA. The following cycling conditions were used: 55˚C for
5 min; 95˚C for 5 min; 40 cycles of 95˚C for 20 sec, 55˚C for
20 sec and 72˚C for 4 min. This cycle was followed by melting
curve analysis, and the baseline and cycle threshold values
(Cq values) were automatically determined for all the
plates using Roche LightCycler 480 software v1.5.0 (Roche
Diagnostics GmbH). RT‑qPCR amplication products were
detected by 1% agarose gel electrophoresis and melting curve
to verify the specicity of the primers. A standard curve was
constructed for each primer pair to determine the product
specicity.
The Cq values were identied by quantitative comparison
of the amplication of the candidate genes. The Cq values
were calculated to relative quantities (Q) for data analysis, in
view of the PCR efciencies of the candidate genes according
to the equation: Q=2
-
ΔΔ
Cq
(20).
PCR efciency. A random pool of cDNA from the samples
was selected and used for 10-fold serial dilutions, ranging
between 0.001 and 1X. PCR analysis was run in triplicate,
as mentioned previously. PCR efficiency was calculated
using the slopes of the calibration curve and by the formula:
E=10
-1
/
slope
.
Table I. Clinicopathological characteristics of patients.
Clinicopathological Patients with
characteristic tongue carcinoma
Age (mean ± standard deviation) 56.75±4.06
Sex
Male 6
Female 2
Histopathological type
Squamous cell carcinomas 8
Adenocarcinoma 0
TNM stage
a
Stage 0 1
Stage I 1
Stage II 3
Stage III 2
Stage IV 1
a
According to the union for international cancer control (17).
ONCOLOGY LETTERS 13: 3951-3957, 2017
3953
Statistical analysis. All the samples were divided into three
groups: Cell line + tissue group, cell line group and tissue
group. In order to evaluate the stability of the reference
genes, three frequently used software programs, geNorm v3.5
Table II. Summary of reference genes used in the present study.
Symbol Ofcial full name Accession number Primer sequence Product size (bp)
18S 18S ribosomal RNA NM_10098.1 F:CGGCTACCACATCCAAGGAA 186
R:GCTGGAATTACCGCGGCT
GAPDH glyceraldehyde-3- NM_002046.5 F: GACAGTCAGCCGCATCTTCT 127
phosphate dehydrogenase R: TTAAAAGCAGCCCTGGTGAC
B2M β-2-microglobulin NM_004048.2 F: AGCGTACTCCAAAGATTCAGGTT 306
R: ATGATGCTGCTTACATGTCTCGAT
ACTB β-actin NM_001101.3 F: AGAAAATCTGGCACCACACC 173
R: TAGCACAGCCTGGATAGCAA
ALAS1 5'-aminolevulinate synthase 1 NM_000688.5 F: GGCAGCACAGATGAATCAGA 150
R: CCTCCATCGGTTTTCACACT
GUSB glucuronidase β NM_000181.3 F: AGCCAGTTCCTCATCAATGG 160
R: GGTAGTGGCTGGTACGGAAA
HPRT1 hypoxanthine NM_000194.2 F: GACCAGTCAACAGGGGACAT 132
phosphoribosyltransferase 1 R: CCTGACCAAGGAAAGCAAAG
HMBS hydroxymethylbilane synthase NM_000190.3 F: AGTGTGGTGGGAACCAGC 144
R: CAGGATGATGGCACTGAACTC
PPIA peptidylprolyl isomerase A NM_021130.4 F: AGACAAGGTCCCAAAGAC 118
R: ACCACCCTGACACATAAA
PUM1 pumilio RNA-binding NM_001020658.1 F: CAGGCTGCCTACCAACTCAT 217
family member 1 R: GTTCCCGAACCATCTCATTC
RPL29 ribosomal protein L29 NM_000992.2 F: GGCGTTGTTGACCCTATTTC 120
R: GTGTGTGGTGTGGTTCTTGG
TBP TATA-box binding protein NM_003194.4 F: TGCACAGGAGCCAAGAGTGAA 132
R: CACATCACAGCTCCCCACCA
Figure 1. Specicity of RT‑qPCR amplication: (A) 1% agarose gel electrophoresis of RT‑qPCR amplication products. (B) Melting curve analysis. RT‑qPCR,
reverse transcription-quantitative polymerase chain reaction analysis.
WA NG et al: VALIDATION OF RGS IN HUMAN TONGUE CARCINOMA CELL LINES AND TISSUE
3954
(http://medgen.ugent.be/~jvdesomp/genorm/), NormFinder
v0.953 (http://moma.dk/normnder‑software) and BestKeeper
version 1 (http://www.gene-quantification.de/bestkeeper.
html), were utilized. GeNorm is designed to establish refer-
ence genes for RT-qPCR and is used to analyze and determine
the M-value, which refers to the stability of the reference gene
expression. M is the mean pairwise variation for a given gene
compared with other tested genes, following stepwise exclu-
sion of the gene with the highest M value and calculated in
order to select the most two stable genes. The default value
suggested by geNorm is M=1.5. A higher M-value indicates
less stable expression, and a lower M value indicates more
stable expression. If M >1.5, the gene is not suitable for use
as a reliable reference gene. GeNorm software was also used
to analyze the pair-wise variation value of the normalization
factor (V), which has a default value of 0.15. It is possible to
use the value of Vn/Vn+1 to determine whether adding a novel
reference gene affects the normalization factor. If the value
of Vn/Vn+1 is >0.15, it is necessary to use the n+1 reference
genes as internal controls. If it is <0.15, then it is not neces-
sary to use novel reference genes. NormFinder software is a
tool designed to identify the optimal reference gene among
a set of candidates and it has a similar operation principle to
geNorm. This program analyzes expression data, ranks the set
of candidate normalization genes according to their expression
stability and considers the gene with the minimum expression
data as the most stable gene. It is also possible to use this
software to compare the stability of inter and intragroup refer-
ence genes and propose an optimal combination of two genes.
BestKeeper evaluates candidate reference gene stability based
on the correlation coefcient (R‑value). The genes were ranked
according to their R value, with a higher R value indicating a
more stable and reliable gene.
Results
Amplification specificity and efficiency of primers. The
primer sequences, corresponding length of the amplified
products and PCR amplification efficiency are listed in
Table II. The gel imaging system indicated that the size of
the amplied fragment was consistent with the expected size,
with a clear band and without primer dimers and nonspecic
bands (Fig. 1A). In addition, melting curve analysis of each
gene fragment amplied by qPCR revealed that all curves
exhibited a single signal peak (Fig. 1B). For the candidate
reference genes, the amplication efciency range of the
standard curve was 1.95‑2.09 and all correlation coefcients
were >0.96.
Gene expression levels. The expression level of the candidate
reference genes was determined by the Cq value, which is
inversely proportional to the expression level of the gene.
Higher Cq values indicated smaller expression quantities. The
Cq value of all the samples ranged between 7.70 and 32.93
(Fig. 2). In all groups, 18S had the smallest mean Cq values
of 9.48±1.51 (cell line + tissue group; Fig. 2A), 8.38±0.43 (cell
line group; Fig. 2B) and 10.30±1.52 (tissue group; Fig. 2C)
and HMBS had the greatest mean Cq values of 26.41±2.37
(cell line + tissue group; Fig. 2A), 25.06±1.70 (cell line group;
Fig. 2B) and 27.43±2.37 (tissue group; Fig. 2C).
Stability analysis of the candidate reference gene.
Theoretically, the 12 reference genes constituted appropriate
internal controls for gene expression. In the cell line + tissue
group, ALAS1 and RPL29 had the lowest M-values, followed
by GUSB, which suggested that these were the most stable
candidate genes for studies between human tongue carcinoma
cell lines and tissue. In the cell line group, B2M and RPL29,
followed by TBP, were suggested as the most stable reference
genes for studies between Tca-8113 and CAL-27 cell lines.
In the tissue group, RPL29 and HPRT1, followed by ALAS1,
were suggested as most stable reference genes for studies on
human tongue carcinoma tissue (Fig. 3A). A combination of
2 and 3 reference genes were optimal in the cell line group
(V2/3=0.116) and tissue group (V3/4=0.103), respectively
(Fig. 3B).
In order to further evaluate the stability of the 12 reference
genes, the present study also used the NormFinder program.
PPIA + HMBS was the most stable reference gene combina-
tion in the cell line + tissue group, whilst GUSB and RPL29
were the most stably expressed genes in this group (Fig. 4A).
In the cell line group, B2M + HMBS was the most stable
reference gene combination, whilst PUM1 and GADPH were
the most stably expressed genes (Fig. 4B). In the tissue group,
PPIA + HMBS was the most stable reference gene combina-
tion, whilst HMBS and GUSB were the most stably expressed
genes (Fig. 4C).
The BestKeeper program was also used to compare
the stability of internal reference genes. As the BestKeeper
program is only able to analyze 10 internal reference genes,
Figure 2. Mean Cq values of the reference genes in the experimental samples
for the (A) cell line+tissue, (B) cell line and (C) tissue groups. Bars represent
the mean ± standard deviation.
ONCOLOGY LETTERS 13: 3951-3957, 2017
3955
the 2 most unstable internal reference genes indicated by
the geNorm software were removed in each group. In terms
of the R-value, the most stable internal reference gene in the
cell line + tissue group was GUSB, followed by ALAS1 and
RPL29 (Fig. 5A). In the cell line group the most stable internal
reference gene was RPL29, followed by B2 M and GAPDH
(Fig. 5B), and in the tissue group the most stable internal
reference gene was RPL29, followed by GUSB and HPRT1
(Fig. 5C).
Figure 3. GeNorm analysis of the candidate reference genes. Results are presented according to the output le of the geNorm program. (A) Stepwise exclusion
of the least stable genes by calculating the M value. The x-axis from left to right indicates the ranking of the reference genes according to their expression
stability and the y-axis indicates M. (B) Determination of the optimal number of reference genes for normalization.
Figure 5. Stability values of the candidate reference genes evaluated using
BestKeeper software for the (A) cell line+tissue, (B) cell line and (C) tissue
groups.
Figure 4. Candidate reference genes for normalization according to their
expression stability for the (A) cell line+tissue, (B) cell line and (C) tissue
groups, calculated using the NormFinder program. The y-axis represents the
stability value. The x-axis from left to right represents the ranking of the
reference genes.