scispace - formally typeset
Journal ArticleDOI

129/Ola mice carrying a null mutation in PrP that abolishes mRNA production are developmentally normal.

Reads0
Chats0
TLDR
The use of a different targeting strategy is reported, to produce inbred mice with a complete absence of both PrP protein and mRNA sequences, which are being used in experiments designed to address the role of PrP in the pathogenesis of scrapie and the replication of infectivity.
Abstract
The neural membrane glycoprotein PrP is implicated in the pathogenesis of the transmissible spongiform encephalopathies; however, the normal function of PrP and its precise role in disease are not understood. Recently, gene targeting has been used to produce mice withneo/PrP fusion transcripts, but no detectable PrP protein in the brain (1). Here we report the use of a different targeting strategy, to produce inbred mice with a complete absence of both PrP protein and mRNA sequences. At 7 mo of age, these mice show no overt phenotypic abnormalities despite the normal high levels of expression of PrP during mouse development. The mice are being used in experiments designed to address the role of PrP in the pathogenesis of scrapie and the replication of infectivity.

read more

Citations
More filters
Journal ArticleDOI

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology

TL;DR: The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.
Journal ArticleDOI

Generation of Sprn -regulated reporter mice reveals gonadic spatial expression of the prion-like protein Shadoo in mice

TL;DR: Reported mice carrying a transgene encompassing the Sprn promoter, exon 1, intron 1 and the 5'-end of exon 2 driving expression of either the LacZ or GFP reporter gene are generated to study the expression profile of Shadoo in mice.
Journal ArticleDOI

Production and characterization of a panel of monoclonal antibodies against native human cellular prion protein.

TL;DR: Several of these monoclonal antibodies showed a selectivity in their ability to immunoprecipitate disease associated PrP(Sc) and its corresponding protease resistant core (PrP(res)).
Journal ArticleDOI

Differential expression of erythroid genes in prion disease

TL;DR: Analysis of blood from BSE- infected cattle and scrapie-infected sheep reveals that the extent of differential expression of erythroid genes within peripheral blood is not sufficient to provide a discriminatory diagnostic test, and further implicate cells of the erythyroid lineage in the peripheral pathogenesis of prion disease.
Journal ArticleDOI

The cellular prion protein promotes olfactory sensory neuron survival and axon targeting during adult neurogenesis.

TL;DR: The results indicate that PrPC plays a role in maintaining mature OSNs within the epithelium: overexpression of PrPC resulted in greater survival of mitotically active cells within the OSE, whereas absence of prion protein resulted in fewer cells being maintained over time.
References
More filters
Journal ArticleDOI

Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction

TL;DR: A new method of total RNA isolation by a single extraction with an acid guanidinium thiocyanate-phenol-chloroform mixture is described, providing a pure preparation of undegraded RNA in high yield and can be completed within 4 h.
Journal ArticleDOI

Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumours

TL;DR: Observations indicate that a normal p53 gene is dispensable for embryonic development, that its absence predisposes the animal to neoplastic disease, and that an oncogenic mutant form of p53 is not obligatory for the genesis of many types of tumours.
Journal ArticleDOI

Site-directed mutagenesis by gene targeting in mouse embryo-derived stem cells.

TL;DR: This work mutated, by gene targeting, the endogenous hypoxanthine phosphoribosyl transferase (HPRT) gene in mouse embryo-derived stem (ES) cells and compared the gene-targeting efficiencies of two classes of neor-Hprt recombinant vectors.
Journal ArticleDOI

Multiple intestinal neoplasia caused by a mutation in the murine homolog of the APC gene.

TL;DR: In this paper, a mouse lineage that exhibits an autosomal dominantly inherited predisposition to multiple intestinal neoplasia (Min) was described and linkage analysis showed that the murine homolog of the APC gene (mApc) was tightly linked to the Min locus.
Related Papers (5)