Showing papers on "Arthrobacter published in 2016"
TL;DR: Emphasis is given to intrageneric phylogeny and chemotaxonomic characteristics, concentrating on quinone systems, peptidoglycan compositions and polar lipid profiles of selected species, from its first description in 1947 to the present state.
Abstract: In this paper, the taxonomy of the genus Arthrobacter is discussed, from its first description in 1947 to the present state. Emphasis is given to intrageneric phylogeny and chemotaxonomic characteristics, concentrating on quinone systems, peptidoglycan compositions and polar lipid profiles. Internal groups within the genus Arthrobacter indicated from homogeneous chemotaxonomic traits and corresponding to phylogenetic grouping and/or high 16S rRNA gene sequence similarities are highlighted. Furthermore, polar lipid profiles and quinone systems of selected species are shown, filling some gaps concerning these chemotaxonomic traits. Based on phylogenetic groupings, 16S rRNA gene sequence similarities and homogeneity in peptidoglycan types, quinone systems and polar lipid profiles, a description of the genus Arthrobacter sensu lato and an emended description of Arthrobacter roseus are provided. Furthermore, reclassifications of selected species of the genus Arthrobacter into novel genera are proposed, namely Glutamicibacter gen. nov. (nine species), Paeniglutamicibacter gen. nov. (six species), Pseudoglutamicibacter gen. nov. (two species), Paenarthrobacter gen. nov. (six species) and Pseudarthrobacter gen. nov. (ten species).
168 citations
TL;DR: Two aerobic sulfadiazine (SDZ) degrading bacterial strains, D2 and D4, affiliated with the genus Arthrobacter, were isolated from SDZ-enriched activated sludge and shared high genomic similarities with the s-triazine-degrading ArthRobacter sp.
Abstract: Two aerobic sulfadiazine (SDZ) degrading bacterial strains, D2 and D4, affiliated with the genus Arthrobacter, were isolated from SDZ-enriched activated sludge. The degradation of SDZ by the two isolates followed first-order decay kinetics. The half-life time of complete SDZ degradation was 11.3 h for strain D2 and 46.4 h for strain D4. Degradation kinetic changed from nongrowth to growth-linked when glucose was introduced as the cosubstrate, and accelerated biodegradation rate was observed after the adaption period. Both isolates could degrade SDZ into 12 biodegradation products via 3 parallel pathways, of which 2-amino-4-hydroxypyrimidine was detected as the principal intermediate product toward the pyrimidine ring cleavage. Compared with five Arthrobacter strains reported previously, D2 and D4 were the only Arthrobacter strains which could degrade SDZ as the sole carbon source. The draft genomes of D2 and D4, with the same completeness of 99.7%, were compared to other genomes of related species. Overal...
120 citations
TL;DR: Genome analysis revealed metabolic versatility with genes involved in metabolism and cold shock adaptation, utilization and biosynthesis of diverse structural and storage polysaccharides such as plant based carbon polymers.
Abstract: Arthrobacter agilis strain L77, is a plant growth promoting and cold active hydrolytic enzymes producing psychrotrophic bacterium, isolated from Pangong Lake, a subglacial lake in north western Himalayas, India. Genome analysis revealed metabolic versatility with genes involved in metabolism and cold shock adaptation, utilization and biosynthesis of diverse structural and storage polysaccharides such as plant based carbon polymers. The genome of Arthrobacter agilis strain L77 consists of 3,608,439 bp (3.60 Mb) of a circular chromosome. The genome comprises of 3316 protein coding genes and 74 RNA genes, 725 hypothetical proteins, 25 pseudo-genes and 1404 unique genes.
81 citations
TL;DR: It is demonstrated that salt-tolerant bacteria isolated from the rhizosphere of wild plants grown on saline–alkaline lands could be used for alleviating salt stress in crop plants.
Abstract: Salt-induced soil degradation is common in farmlands and limits the growth and development of numerous crop plants in the world. In this study, we isolated salt-tolerant bacteria from the rhizosphere of Tamarix chinensis, Suaeda salsa and Zoysia sinica, which are common wild plants grown on a saline-alkaline land, to test these bacteria's efficiency in alleviating salt stress in tomato plants. We screened out seven strains (TF1-7) that are efficient in reducing salt stress in tomato seedlings. The sequence data of 16S rRNA genes showed that these strains belong to Arthrobacter and Bacillus megaterium. All strains could hydrolyze casein and solubilize phosphate, and showed at least one plant growth promotion (PGP)-related gene, indicating their potential in promoting plant growth. The Arthrobacter strains TF1 and TF7 and the Bacillus megaterium strain TF2 and TF3 could produce indole acetic acid under salt stress, further demonstrating their PGP potential. Tomato seed germination, seedling length, vigor index, and plant fresh and dry weight were enhanced by inoculation of Arthrobacter and B. megaterium strains under salt stress. Our results demonstrated that salt-tolerant bacteria isolated from the rhizosphere of wild plants grown on saline-alkaline lands could be used for alleviating salt stress in crop plants.
47 citations
TL;DR: This study is the first report about a genus Arthrobacter bacterium which could simultaneously degrade BPA, BPF, and TBBPA.
Abstract: Arthrobacter sp. strain YC-RL1, capable of utilizing bisphenol A (BPA) as sole carbon source for growth, was isolated from petroleum contaminated soil. YC-RL1 could rapidly degrade BPA in a wide range of pH (5.0-9.0) and temperature (20-40 °C). Substrate analysis found that YC-RL1 could also degrade bisphenol F (BPF) and tetrabromobisphenol A (TBBPA). The maximum and minimum concentrations of BPA (0.2-600 mg/L), BPF (0.2-600 mg/L), and TBBPA (0.2-300 mg/L) for efficient biodegradation were detected. The released bromide ion and metabolic intermediates of BPF and BPA/TBBPA were detected, as well as the degradation pathways for BPF and BPA/TBBPA were deduced tentatively. The present study provides important information for the investigation of BPs degrading mechanism and the application of microbial remediation in BP-contaminated environment. This study is the first report about a genus Arthrobacter bacterium which could simultaneously degrade BPA, BPF, and TBBPA.
43 citations
TL;DR: The combined results of this study support the classification of strain P3B162T as a novel Arth Robacter species and propose Arthrobacter pokkalii sp.nov.as its name.
Abstract: A novel yellow colony-forming bacterium, strain P3B162T was isolated from the pokkali rice rhizosphere from Kerala, India, as part of a project study aimed at isolating plant growth beneficial rhizobacteria from saline tolerant pokkali rice and functionally evaluate their abilities to promote plant growth under saline conditions. The novel strain P3B162T possesses plant growth beneficial traits such as positive growth on 1-aminocyclopropane-1-carboxylic acid (ACC), production of indole acetic acid (IAA) and siderophore. In addition, it also showed important phenotypic characters such as ability to form biofilm and utilization of various components of plant root exudates (sugars, amino acids and organic acids), clearly indicating its lifestyle as a plant rhizosphere associated bacterium. Taxonomically, the novel strain P3B162T was affiliated to the genus Arthrobacter based on the collective results of phenotypic, genotypic and chemotaxonomic analyses. Moreover, molecular analysis using 16S rRNA gene showed Arthrobacter globiformis NBRC 12137T, Arthrobacter pascens DSM 20545T and Arthrobacter liuii DSXY973T as the closely related phylogenetic neighbours, showing more than 98% 16S rRNA similarity values, whereas the recA gene analysis displayed Arthrobacter liuii JCM 19864T as the nearest neighbour with 94.7% sequence similarity and only 91.7% to Arthrobacter globiformis LMG 3813T and 88.7% to Arthrobacter pascens LMG 16255T. However, the DNA-DNA hybridization values between strain P3B162T, Arthrobacter globiformis LMG 3813T, Arthrobacter pascens LMG 16255T and Arthrobacter liuii JCM 19864T was below 50%. In addition, the novel strain P3B162T can be distinguished from its closely related type strains by several phenotypic characters such as colony pigment, tolerance to NaCl, motility, reduction of nitrate, hydrolysis of DNA, acid from sucrose, cell wall sugars and cell wall peptidoglycan structure. In conclusion, the combined results of this study support the classification of strain P3B162T as a novel Arthrobacter species and we propose Arthrobacter pokkalii sp.nov.as its name. The type strain is P3B162T (= KCTC 29498T = MTCC 12358T).
39 citations
TL;DR: The present study illustrates: (i) rhizosphere of D. annulatum colonizing abandoned mine as a “hotspot” of siderophore‐producing bacteria; and (ii) potential of A. globiformis BGDa404 inoculation to increase iron‐stress resilience in maize.
Abstract: Iron deficiency is common among graminaceous crops. Ecologically successful wild grasses from iron-limiting habitats are likely to harbour bacteria which secrete efficient high-affinity iron-chelating molecules (siderophores) to solubilize and mobilize iron. Such siderophore-producing rhizobacteria may increase the iron-stress resilience of graminaceous crops. Considering this, 51 rhizobacterial isolates of Dichanthium annulatum from iron-limiting abandoned mine (∼84% biologically unavailable iron) were purified and tested for siderophore production; and efficacy of Arthrobacter globiformis inoculation to increase iron-stress resilience of maize and wheat was also evaluated. 16S rRNA sequence analyses demonstrated that siderophore-producing bacteria were taxonomically diverse (seven genera, nineteen species). Among these, Gram-positive Bacillus (eleven species) was prevalent (76.92%). A. globiformis, a commonly found rhizobacterium of graminaceous crops was investigated in detail. Its siderophore has high iron-chelation capacity (ICC: 13.0 ± 2.4 μM) and effectively dissolutes diverse iron-complexes (FeCl3 : 256.13 ± 26.56 μM/ml; Fe2 O3 red: 84.3 ± 4.74 μM/ml; mine spoil: 123.84 ± 4.38 μM/ml). Siderophore production (ICC) of A. globiformis BGDa404 also varied with supplementation of different iron complexes. In plant bioassay with iron-deficiency sensitive species maize, A. globiformis inoculation triggered stress-associated traits (peroxidase and proline) in roots, enhanced plant biomass, uptake of iron and phosphate, and protein and chlorophyll contents. However, in iron deficiency tolerant species wheat, growth improvement was marginal. The present study illustrates: (i) rhizosphere of D. annulatum colonizing abandoned mine as a "hotspot" of siderophore-producing bacteria; and (ii) potential of A. globiformis BGDa404 inoculation to increase iron-stress resilience in maize. A. globiformis BGDa404 has the potential to develop as bioinoculant to alleviate iron-stress in maize.
37 citations
TL;DR: Pseudomonas sp.
Abstract: Heavy metal-resistant bacteria can be efficient bioremediators of metals and may provide an alternative or additional method to conventional methods of metal removal. In this study, 10 bacterial isolates were isolated from soil samples of a sugar industry, located at Peshawar, Pakistan. Morphological, physiological, and biochemical characteristics of these isolates were observed. Sequence analysis (16S ribosomal RNA) revealed that isolated strains were closely related to the species belonging to the genera Pseudomonas, Arthrobacter, Exiguobacterium, Citrobacter, and Enterobacter. Bacterial isolates were resistant with a minimum inhibitory concentration (500–900 ppm) to lead ion (Pb2+), (500–600 ppm) nickel ion (Ni2+), (500–800 ppm) copper ion (Cu2+), and (600–800 ppm) chromium ion (Cr3+) in solid media. Furthermore, biosorption of metals proved considerable removal of heavy metals by isolated metal-resistant strains. Pseudomonas sp. reduced 37% (Pb2+), 32% (Ni2+), 29% (Cu2+), and 32% (Cr3+) and was thus f...
36 citations
TL;DR: The flagellar operon found in the AK-YN10 draft genome suggests motility, an interesting trait for a bioremediation agent, and was homologous to that of Arthrobacter chlorophenolicus.
Abstract: The Arthrobacter sp. strain AK-YN10 is an s-triazine pesticide degrading bacterium isolated from a sugarcane field in Central India with history of repeated atrazine use. AK-YN10 was shown to degrade 99 % of atrazine in 30 h from media supplemented with 1000 mg L(-1) of the herbicide. Draft genome sequencing revealed similarity to pAO1, TC1, and TC2 catabolic plasmids of the Arthrobacter taxon. Plasmid profiling analyses revealed the presence of four catabolic plasmids. The trzN, atzB, and atzC atrazine-degrading genes were located on a plasmid of approximately 113 kb.The flagellar operon found in the AK-YN10 draft genome suggests motility, an interesting trait for a bioremediation agent, and was homologous to that of Arthrobacter chlorophenolicus. The multiple s-triazines degradation property of this isolate makes it a good candidate for bioremediation of soils contaminated by s-triazine pesticides.
34 citations
TL;DR: The findings suggest that the extracellular chromate reductase of Arthrobacter sp.
30 citations
TL;DR: The study highlights that indigenous U ore deposit bacteria have the potential to interact with U, and thus could be applied for bioremediation of U contaminated sites or wastes.
TL;DR: The results indicate that Arthrobacter sp.
Abstract: In the present work, Arthrobacter sp 25, a lead-tolerant bacterium, was assayed to remove lead(II) from aqueous solution The biosorption process was optimized by response surface methodology (RSM) based on the Box-Behnken design The relationships between dependent and independent variables were quantitatively determined by second-order polynomial equation and 3D response surface plots The biosorption mechanism was explored by characterization of the biosorbent before and after biosorption using atomic force microscopy (AFM), scanning electron microscopy, energy dispersive X-ray spectroscopy, X-ray diffraction, and Fourier transform infrared spectroscopy The results showed that the maximum adsorption capacity of 96 mg/g was obtained at the initial lead ion concentration of 10879 mg/l, pH value of 575, and biosorbent dosage of 99 g/l (fresh weight), which was close to the theoretically expected value of 988 mg/g Arthrobacter sp 25 is an ellipsoidalshaped bacterium covered with extracellular polymeric substances The biosorption mechanism involved physical adsorption and microprecipitation as well as ion exchange, and functional groups such as phosphoryl, hydroxyl, amino, amide, carbonyl, and phosphate groups played vital roles in adsorption The results indicate that Arthrobacter sp 25 may be potentially used as a biosorbent for low-concentration lead(II) removal from wastewater
TL;DR: Actinobacteria, specifically the Arthrobacter genus, were abundant along with members of the α- and β-Proteobacteria classes, and CFU count ratios between l- and d-amino acids typically ranged between 2 and 1.
Abstract: Soil and rhizosphere environments were examined in order to determine the identity and relative abundance of bacteria that catabolize d- and l-amino acids as the sole source of carbon and nitrogen. All substrates were readily catabolized by bacteria from both environments, with most d-amino acids giving similar CFU counts to their l-amino acid counterparts. CFU count ratios between l- and d-amino acids typically ranged between 2 and 1. Isolates were phylogenetically typed in order to determine the identity of d-amino acid catabolizers. Actinobacteria, specifically the Arthrobacter genus, were abundant along with members of the α- and β-Proteobacteria classes.
TL;DR: A great potential of Arthrobacter sp.
Abstract: The s-triazine herbicide, atrazine, has been well acknowledged as an important source causing contamination of soil, water, and sediment. Functional bacteria are one of the critical candidates for removing residual atrazine from contaminated environments. Here, seven bacterial strains showing atrazine-degrading ability were isolated from long-term atrazine-contaminated corn field and identified based on 16S rRNA gene sequencing. Among these bacterial isolates, a bacterium, later designated as Arthrobacter sp. C3, was found to be capable of completely degrading 25 mg/l atrazine. The high-performance liquid chromatography-mass spectrometry (HPLC-MS) analysis indicated that the atrazine was dechlorinated to hydroxyatrazine, a non-phytotoxic compound. The functional gene, trzN, which participates in the first step of atrazine degradation was successfully amplified and showed high similarity to the known trzN genes from different bacterial genera. Based on the HPLC-MS and the functional gene analysis, the functional bacterium C3 was speculated to degrade atrazine via dechlorination, which detoxified the herbicide. This study suggested a great potential of Arthrobacter sp. C3 to be used in indigenous bioremediation of atrazine in field.
TL;DR: This study reports the first report of the occurrence of this compound active against a wide variety of Gram-positive and negative bacteria and fungi in the genus Arthrobacter, isolated from a mango orchard in Krishna District, Andhra Pradesh (India).
TL;DR: The present report highlights the superior tolerance and binding capacity of the KMSZP6 strain for cesium and strontium over other earlier reported strains and reveals its potential for bioremediation of nuclear waste.
Abstract: Arthrobacter sp. KMSZP6 isolated from a pristine uranium ore deposit at Domiasiat located in North-East India exhibited noteworthy tolerance for cesium (Cs) and strontium (Sr). The strain displayed a high minimum inhibitory concentration (MIC) of 400 mM for CsCl and for SrCl2. Flow cytometric analysis employing membrane integrity indicators like propidium iodide (PI) and thiazole orange (TO) indicated a greater sensitivity of Arthrobacter cells to cesium than to strontium. On being challenged with 75 mM of Cs, the cells sequestered 9612 mg Cs g−1 dry weight of cells in 12 h. On being challenged with 75 mM of Sr, the cells sequestered 9989 mg Sr g−1 dry weight of cells in 18 h. Heat killed cells exhibited limited Cs and Sr binding as compared to live cells highlighting the importance of cell viability for optimal binding. The association of the metals with Arthrobacter sp. KMSZP6 was further substantiated by Field Emission-Scanning Electron Microscopy (FE-SEM) coupled with Energy dispersive X-ray (EDX) spectroscopy. This organism tolerated up to 1 kGy 60Co-gamma rays without loss of survival. The present report highlights the superior tolerance and binding capacity of the KMSZP6 strain for cesium and strontium over other earlier reported strains and reveals its potential for bioremediation of nuclear waste.
TL;DR: It was concluded that the use of rhizospheric bacteria for inoculation seawater and desert soil and of bacteria in long-contaminated soil for inoculating desert soil follows the concept of “autochthonous bioaugmentation.”
Abstract: Oil-contaminated seawater and desert soil batches were bioaugmented with suspensions of pea (Pisum sativum) rhizosphere and soil with long history of oil pollution. Oil consumption was measured by gas-liquid chromatography. Hydrocarbonoclastic bacteria in the bioremediation batches were counted using a mineral medium with oil vapor as a sole carbon source and characterized by their 16S ribosomal RNA (rRNA)-gene sequences. Most of the oil was consumed during the first 2–4 months, and the oil-removal rate decreased or ceased thereafter due to nutrient and oxygen depletion. Supplying the batches with NaNO3 (nitrogen fertilization) at a late phase of bioremediation resulted in reenhanced oil consumption and bacterial growth. In the seawater batches bioaugmented with rhizospheric suspension, the autochthonous rhizospheric bacterial species Microbacterium oxidans and Rhodococcus spp. were established and contributed to oil-removal. The rhizosphere-bioaugmented soil batches selectively favored Arthrobacter nitroguajacolicus, Caulobacter segnis, and Ensifer adherens. In seawater batches bioaugmented with long-contaminated soil, the predominant oil-removing bacterium was the marine species Marinobacter hydrocarbonoclasticus. In soil batches on the other hand, the autochthonous inhabitants of the long-contaminated soil, Pseudomonas and Massilia species were established and contributed to oil removal. It was concluded that the use of rhizospheric bacteria for inoculating seawater and desert soil and of bacteria in long-contaminated soil for inoculating desert soil follows the concept of “autochthonous bioaugmentation.” Inoculating seawater with bacteria in long-contaminated soil, on the other hand, merits the designation “allochthonous bioaugmentation.”
TL;DR: The results of the phylogenetic, phenotypic and genotypic analysis indicate that strain AM23T represents a novel species in the genus Arthrobacter, for which the name Arth Robacter echini sp.
Abstract: A novel strain, designated AM23T, was isolated from the gut of a purple sea urchin Heliocidaris crassispina collected from the coastal waters of the Korean island Dokdo. 16S rRNA gene sequence analysis showed that strain AM23T belonged to the genus Arthrobacter in the family Micrococcaceae and shared highest sequence similarity with Arthrobacter agilis DSM 20550T (98.77 %). Strain AM23T was catalase-positive, oxidase-negative and grew optimally at 20 °C, in the presence of 1 % (w/v) NaCl and at pH 7. The isolate was a Gram-stain-positive, non-motile, strictly aerobic and coccus-shaped bacterium. The major cellular fatty acids were anteiso-C15 : 0 and iso-C15 : 0. The polar lipids of strain AM23T were phosphatidylglycerol, diphosphatidylglycerol, phosphatidylinositol, one unidentified glycolipid and four unidentified lipids. The components of the cell-wall peptidoglycan were lysine, glutamic acid and alanine and the predominant cell-wall sugars were galactose, mannose, rhamnose and ribose. The major respiratory quinone was identified as menaquinone MK-9(H2). The genomic DNA G+C content was 67.3 mol% and the DNA–DNA hybridization values showed the strain shared less than 29 % genomic relatedness with A. agilis DSM 20550T. The results of the phylogenetic, phenotypic and genotypic analysis indicate that strain AM23T represents a novel species in the genus Arthrobacter, for which the name Arthrobacter echini sp. nov. is proposed. The type strain is AM23T ( = KACC 18260T = DSM 29493T).
TL;DR: The present study will help to explain the degradation of indole by different bacteria and also the pathways through which it is catabolized and could be potentially useful for the in situ attenuation of odorant indole and its derivatives emitted from different types of livestock waste.
Abstract: Indole is an interspecies and interkingdom signaling molecule widespread in different environmental compartment. Although multifaceted roles of indole in different biological systems have been established, little information is available on the microbial utilization of indole in the context of combating odor emissions from different types of waste. The present study was aimed at identifying novel bacteria capable of utilizing indole as the sole carbon and energy source. From the selective enrichment of swine waste and cattle feces, we identified Gram-positive and Gram-negative bacteria belonging to the genera Arthrobacter and Alcaligenes. Bacteria belonging to the genus Alcaligenes showed higher rates of indole utilization than Arthrobacter. Indole at 1.0 mM for growth was completely utilized by Alcaligenes sp. in 16 h. Both strains produced two intermediates, anthranilic acid and isatin, during aerobic indole metabolism. These isolates were also able to grow on several indole derivatives. Interestingly, an adaptive response in terms of a decrease in cell size was observed in both strains in the presence of indole. The present study will help to explain the degradation of indole by different bacteria and also the pathways through which it is catabolized. Furthermore, these novel bacterial isolates could be potentially useful for the in situ attenuation of odorant indole and its derivatives emitted from different types of livestock waste.
TL;DR: It is concluded that endophytic bacteria possessed greater potential for copper tolerance and bioremediation.
Abstract: The present study was conducted to investigate copper tolerance and bioremediation potential in endophytic bacteria isolated from Vigna unguiculata root nodules. Total ten endophytes were isolated on yeast mannitol agar and enriched in copper (II) sulfate (CuSO4) up to 500 mg/L. Four endophytes belonging to genera Bacillus and Arthrobacter showed copper tolerance. The isolates were identified as Arthrobacter tumbae MYR1, Bacillus safensis MYR2, Bacillus pumilus MYR3 and Bacillus sp. MYR4 using 16S ribosomal RNA (rRNA) analysis. Response surface methodology was used for copper (II) removal optimization. The model was significant with R
2, P and F value of 0.9780, <0.0001, and 34.54, respectively. Results showed that highest copper (II) bioremoval of 82.8 % was obtained at pH 5.0, temperature 32.5 °C, and 600 mg/L copper concentration after 168 h of incubation. The isolates were tested for plant growth promotion and all the strains produced indole acetic acid (IAA) and showed 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase activity. The study concludes that endophytic bacteria possessed greater potential for copper tolerance and bioremediation.
TL;DR: Analysis of soil atrazine-degrading bacteria based on their direct isolation provided evidence that contaminated soils harbored communities of genetically distinct bacteria capable of individually degrading and utilizing atrazin.
Abstract: Soil populations of bacteria rapidly degrading atrazine are critical to the environmental fate of the herbicide. An enrichment bias from the routine isolation procedure prevents studying the diversity of atrazine degraders. In the present work, we analyzed the occurrence, diversity and community structure of soil atrazine-degrading bacteria based on their direct isolation. Atrazine-degrading bacteria were isolated by direct plating on a specially developed SM agar. The atrazine degradation genes trzN and atzABC were detected by multiplex PCR. The diversity of atrazine degraders was characterized by enterobacterial repetitive intergenic consensus-PCR (ERIC-PCR) genotyping followed by 16S rRNA gene phylogenetic analysis. The occurrence of atrazine-degrading bacteria was also assessed by conventional PCR targeting trzN and atzABC in soil DNA. A total of 116 atrazine-degrading isolates were recovered from bulk and rhizosphere soils sampled near an atrazine factory and from geographically distant maize fields. Fifteen genotypes were distinguished among 56 industrial isolates, with 13 of them representing eight phylogenetic groups of the genus Arthrobacter. The remaining two were closely related to Pseudomonas alcaliphila and Gulosibacter molinativorax and constituted major components of the atrazine-degrading community in the most heavily contaminated industrial plantless soil. All isolates from the adjacent sites inhabited by cogon grass or common reed were various Arthrobacter spp. with a strong prevalence of A. aurescens group. Only three genotypes were distinguished among 60 agricultural strains. Genetically similar Arthrobacter ureafaciens bacteria which occurred as minor inhabitants of cogon grass roots in the industrial soil were ubiquitous and predominant atrazine degraders in the maize rhizosphere. The other two genotypes represented two distant Nocardioides spp. that were specific to their geographic origins. Direct plating on SM agar enabled rapid isolation of atrazine-degrading bacteria and analysis of their natural diversity in soil. The results obtained provided evidence that contaminated soils harbored communities of genetically distinct bacteria capable of individually degrading and utilizing atrazine. The community structures of culturable atrazine degraders were habitat-specific. Bacteria belonging to the genus Arthrobacter were the predominant degraders of atrazine in the plant rhizosphere.
TL;DR: The complete genome sequence of strain YC-RL1 is reported, which may facilitate the investigation of environmental bioremediation and provide new gene resources for biotechnology and gene engineering.
01 Apr 2016
TL;DR: The characteristics of these bacterial isolates suggests that they may be responsible for the breakdown of PAH of different mol wt in the composts, and may be potentially useful for bioremediation of oil sludge during compost biOREmediation.
Abstract: In the present study, different bacteria with polycyclic aromatic hydrocarbon (PAH)-degrading capabilities were isolated from compost prepared from oil sludge and animal manures. These bacteria were isolated on a mineral base medium and mineral salt agar plates. A total of 31 morphologically distinct isolates were carefully selected from 5 different compost treatments for identification using polymerase chain reaction (PCR) of the 16S rRNA gene with specific primers (16S-P1 PCR (5′AGAGTTTGATCCTGGCTCAG3′) and 16S-P2 PCR (5′AAGGAGGTGATCCAGCCGCA3′). The amplicons were sequenced using 16S-PA SEQ (5/CTACGGGAGGCAGCAG3/) and sequences were compared with the known nucleotides from the GenBank. The phylogenetic analyses of the isolates showed that they belong to 3 different clades: Firmicutes, Proteobacteria and Actinobacteria. The bacteria identified were closely related to the genera Bacillus, Arthrobacter, Staphylococcus, Brevibacterium, Variovorax, Paenibacillus, Ralstonia and Geobacillus. The results showed that Bacillus species were predominant in all composts. Based on the results of the degradation of the PAH in the composts and results of previous studies on bacterial degradation of hydrocarbons in oil, the characteristics of these bacterial isolates suggests that they may be responsible for the breakdown of PAH of different mol wt in the composts. Thus, they may be potentially useful for bioremediation of oil sludge during compost bioremediation.
TL;DR: The availability of this genome sequence allows us to investigate the genetic basis of adaptation to growth in a nutrient-poor permafrost environment and to evaluate of the biofuel-synthetic potential of this species.
TL;DR: The draft genome sequence of OY3WO11 may represent a novel species of Arthrobacter, which inhibits the growth of the potato pathogen Phytophthora infestans in in vivo growth challenge assays.
Abstract: Arthrobacter sp. strain OY3WO11 inhibits the growth of the potato pathogen Phytophthora infestans in in vivo growth challenge assays. We determined the draft genome sequence of this strain, assembling it into 3 scaffolds of 4.2 Mbp total length. OY3WO11 may represent a novel species of Arthrobacter.
TL;DR: In this study, label-free quantitative proteomics method based on liquid chromatography-electrospray ionization-tandem mass spectrometry was used to dissect the mechanism of swainsonine biodegradation by Arthrobacter sp.
Abstract: Swainsonine is an indolizidine alkaloid that has been found in locoweeds and some fungi. Our previous study demonstrated that Arthrobacter sp. HW08 or its crude enzyme extract could degrade swainsonie efficiently. However, the mechanism of swainsonine degradation in bacteria remains unclear. In this study, we used label-free quantitative proteomics method based on liquid chromatography-electrospray ionization-tandem mass spectrometry to dissect the mechanism of swainsonine biodegradation by Arthrobacter sp. HW08. The results showed that 129 differentially expressed proteins were relevant to swainsonine degradation. These differentially expressed proteins were mostly related to the biological process of metabolism and the molecular function of catalytic activity. Among the 129 differentially expressed proteins, putative sugar phosphate isomerase/epimerase A1R5X7, Acetyl-CoA acetyltransferase A0JZ95, and nicotinamide adenine dinucleotide phosphate (NADP)-dependent alcohol dehydrogenase A1R6C3 were found to contribute to the swainsonine degradation. Notably, NADP-dependent alcohol dehyrodgenase A1R6C3 appeared to play a major role in degrading swainsonine, but not as much as Arthrobacter sp. HW08 did. Collectively, our findings here provide insights to understand the mechanism of swainsonine degradation in bacteria.
TL;DR: A lipase producer psychrophilic microorganism isolated from Arctic sample was studied and it was revealed that the isolate is closely related to Arthrobacter gangotriensis (97% similarity).
Abstract: A lipase producer psychrophilic microorganism isolated from Arctic sample was studied. The genomic DNA of the isolate was extracted using modified CTAB method. Identification of the isolate by morphological and 16S rRNA sequence analysis revealed that the isolate is closely related to Arthrobacter gangotriensis (97% similarity). A. gangotriensis was determined as positive lipase producer based on the plate screening using specific and sensitive plate assay of Rhodamine B. The PCR result using Arthrobacter sp.'s full lipase gene sequence as the template primers emphasised a possible lipase gene at 900 bp band size. The gene is further cloned in a suitable vector system for expression of lipase.
15 Mar 2016
TL;DR: Arthrobacter arilaitensis Y-10 could conduct nitrification and denitrification effectively under aerobic condition and the ammonium nitrogen removal rate was more than 80.0% in the inorganic nitrogen mixed synthetic wastewater.
Abstract: High concentrations of ammonium, nitrate and nitrite nitrogen were employed to clarify the abilities of heterotrophic nitrification and aerobic denitrification of Arthrobacter arilaitensis strain Y-10. Meanwhile, by means of inoculating the strain suspension into the mixed ammonium and nitrate, ammonium and nitrite nitrogen simulated wastewater, we studied the simultaneous nitrification and denitrification ability of Arthrobacter arilaitensis strain Y-10. In addition, cell optical density was assayed in each nitrogen removal process to analyze the relationship of cell growth and nitrogen removal efficiency. The results showed that the hypothermia denitrification strain Arthrobacter arilaitensis Y-10 exhibited high nitrogen removal efficiency during heterotrophic nitrification and aerobic denitrification. The ammonium, nitrate and nitrite removal rates were 65.0%, 100% and 61.2% respectively when strain Y-10 was cultivated for 4 d at 15°C with initial ammonium, nitrate and nitrite nitrogen concentrations of 208.43 mg · L⁻¹, 201.16 mg · L⁻¹ and 194.33 mg · L⁻¹ and initial pH of 7.2. Nitrite nitrogen could only be accumulated in the medium containing nitrate nitrogen during heterotrophic nitrification and aerobic denitrification process. Additionally, the ammonium nitrogen was mainly removed in the inorganic nitrogen mixed synthetic wastewater. In short, Arthrobacter arilaitensis Y-10 could conduct nitrification and denitrification effectively under aerobic condition and the ammonium nitrogen removal rate was more than 80.0% in the inorganic nitrogen mixed synthetic wastewater.
TL;DR: When the strains were pre-cultured in R2A broth containing melamine, the degradation rate of melamine in soil increased remarkably, and the highest melamine degradation rate was noted when strain MCO was used with betaine addition.
Abstract: This study aimed to investigate the biodegrading potential of Arthrobacter sp. MCO, Arthrobacter sp. CSP, and Nocardioides sp. ATD6 in melamine-contaminated upland soil (melamine: approx. 10.5 mg/kg dry weight) after 30 days of incubation. The soil sample used in this study had undergone annual treatment of lime nitrogen, which included melamine; it was aged for more than 10 years in field. When R2A broth was used as the pre-culture medium, Arthrobacter sp. MCO could degrade 55 % of melamine after 30 days of incubation, but the other strains could hardly degrade melamine (approximately 25 %). The addition of trimethylglycine (betaine) in soil as an activation material enhanced the degradation rate of melamine by each strain; more than 50 % of melamine was degraded by all strains after 30 days of incubation. In particular, strain MCO could degrade 72 % of melamine. When the strains were pre-cultured in R2A broth containing melamine, the degradation rate of melamine in soil increased remarkably. The highest (72 %) melamine degradation rate was noted when strain MCO was used with betaine addition.
TL;DR: The natural biotic capacity of water to degrade a mixture of four chlorinated hydrocarbons; DDT, DDE, Lindane and Endrin was investigated and the magnitude of growth inhibition was found to be a function of the pesticide mixture concentration, bacterial species and the exposure time.
Abstract: Isolation and selection of potent degradative microorganisms against naturally persistent compounds considered as a powerful means for environmental detoxification. In the present study, the natural biotic capacity of water to degrade a mixture of four chlorinated hydrocarbons; DDT (1,1,1,-trichloro-2,2-bis (p-chlorophenyl) ethane); DDE (1,1-dichloro-2,2-bis (p-chlorophenyl) ethane); Lindane (1,2,3,4,5,6-hexachlorocyclohexane (γ-HCH); Endrin (1,2,3,4,10,10,hexachloro-6,7-epoxy-1, 4,4a,5,6,7,8a-octahydro-1,4-endo-5,8-dimethanophethalene) at two elevated levels (0.05 and 50 ppm) was investigated. Five bacterial species (Pseudmonas cepacia, Enterobacter agglomerans, Arthrobacter sp., Eschericia coli and Staphylococcus aureus) isolated and identified from a heavily polluted lake (L. Mariut) were investigated as biodegraders during the present work. Also, the ability of these pesticides to challenge the growth of the selected species has been examined. The tested bacterial species found to efficiently promote the degradation of the tested compounds. Degradation of DDT, DDE, Lindaine and Endrin were mediated by all the species. At the low concentration (0.05 ppm), the pesticide mixture was diminished by P. cepacia after 24 h exposure. On the other hand, Arthrobacter sp., E. coli, S. aureus and E. agglomerans were able to degrade the pesticide mixture totally after 48, 72, 72 and 96 h, respectively. At the high concentration (50.0 ppm), the tested bacteria were able to degrade >87.0% of the pesticide mixture. The inhibitory effect (p<0.001) of the pesticides mixture (DDT, DDE, Lindane and Endrin) on the bacterial growth at 0.05 and 50.0 ppm was noticed. The magnitude of growth inhibition was found to be a function of the pesticide mixture concentration, bacterial species and the exposure time.