Showing papers on "Sativum published in 2014"

Response of different crops to soil compaction—Short-term effects in Swedish field experiments

Abstract: Soil compaction is generally regarded as negative for crop growth, although many studies show a curvilinear relationship between bulk density and crop yield. In the literature, there are few systematic studies of differences between crop species in their response to compaction. This study used results from short-term Swedish field experiments to analyse the sensitivity of different crops to compaction. The crops included were barley ( Hordeum vulgare L.), horse bean ( Vicia faba L.), oilseed rape ( Brassica napus L.), oilseed turnip rape ( Brassica rapa ssp. oleifera (DC.) Metzg.), oats ( Avena sativa L.), peas ( Pisum sativum L.), potato ( Solanum tuberosum L.), rye ( Secale cereale L.), sugar beet ( Beta vulgaris L.), and wheat ( Triticum aestivum L.). In total 39 experiments were analysed, in two series with spring-sown crops and one with autumn-sown crops, all on soils loosened by mouldboard ploughing. The experiments included different levels of tractor traffic applied track-by-track at the time of seedbed preparation, and a control treatment with no traffic. Bulk density was determined after traffic and expressed as degree of compactness (DC), which is the bulk density in percentage of a reference density. With moderate recompaction, wheat and barley showed a yield increase compared with untrafficked soil, while other crops showed little or no yield increase on average. Oats reacted more negatively to compaction than wheat and barley. Monocots generally had a higher optimum DC than dicots, but the differences were small. Yield losses at high DC values were greater for dicots, especially pea and horse bean crops, although for sugar beet and oilseed rape there was no clear difference compared with cereal crops.

Acaricidal effect of herbal extracts against cattle tick Rhipicephalus ( Boophilus ) microplus using in vitro studies

Abstract: The crude methanolic extract of Datura stramonium, Azadirachta indica, and Calotropis procera leaves, Allium sativum (AS) cloves, and Carica papaya (CP) seeds collected from Banaskanta, Gujarat (India) was tested for its acaricidal properties against Rhipicephalus (Boophilus) microplus. The percent adult mortality within 15 days, reproductive index, percentage inhibition of oviposition, hatching of laid ova, and percentage larval mortality were studied at concentrations of 12.5, 25, 50, and 100 mg/ml. At the highest concentration (100 mg/ml), the adult tick mortality was 66.67, 73.33, 80.00, and 93.33 % for C. procera, D. stramonium, A. sativum, and C. papaya extracts, respectively, and it was statistically significant (P < 0.001). However, for A. indica, mortality was low and estimated to be 33.33 %. Inhibition of oviposition at the highest concentration of A. indica, C. procera, D. stramonium, A. sativum, and C. papaya extract-treated ticks was 20.73, 71.34, 77.17, 85.83, and 100.00 %, respectively. Inhibition of fecundity of treated groups differed significantly from the control and was concentration dependent. Larvae treated with all the tested concentrations of A. indica, C. procera, D. stramonium, A. sativum, and C. papaya extracts by larval packet test showed significant mortality (P < 0.001) than that of control tick larvae, and at the highest concentration, it was 55.2, 63.2, 71.8, 69.0, and 82.2 %, respectively. Garlic cloves and papaya seed extract produced complete failure of eclosion of eggs from the treated ticks even at lower concentrations; however, neem, calotropis, and datura was capable of reducing hatchability by 20, 50, and 70 %, respectively. The results pointed that the crude extracts of A. sativum cloves and C. papaya seeds have very good acaricidal properties and could be a potential component of alternative R. (B.) microplus tick control strategy.

The effect of salinity (NaCl) on germination and early seedling growth of Lathyrus sativus and Pisum sativum var. abyssinicum

Abstract: High salt level of a germination medium may induce a reduction, delay and even complete inhibition of germination due to osmotic effect and/or ion toxicity. The objective of this study was to investigate the effect of salinity due to NaCl on germination and early seedling growth of two crops, Pisum sativum var. abyssinicum and Lathyrus sativus. Seeds of these two crops were treated with NaCl induced saline germinating media prepared in Petri dishes. Fifty (50) surface sterilized seeds per Petri dish were sown in five salt treatments (0, 5, 7, 9 and 15 dSm-). Each treatment was replicated four times. Germination percentage, shoot length and root length of both crops decreased with an increase in salinity level. Although both crops are low salt tolerant legumes, P. sativum var. abyssinium was found to be less tolerant than L. sativus. This study could be strengthened by further work under field conditions and also at mature vegetative and reproductive stages of the crops. Key words: Germination time, water uptake percentage, salt tolerance, seedling biomass.

Effects of Allium sativum essence oil as antimicrobial agent for food packaging plastic film

Abstract: This research is focused on the development of antimicrobial (AM) plastic packaging by using blown film extrusion machine. Plastic films incorporated with 0, 2, 4, 6 and 8% Allium sativum essence oil (AEO) (% w/w) were tested for AM activities against beef related bacteria namely Listeria monocytogenes , Escherichia coli and Brochothrix thermosphacta . Mechanical properties, thermal properties and microstructure of films were investigated to justify the effects of AEO on the film physicomechanical functionality. The retraction zone in agar disk diffusion result shows that low-density-polyethylene/ethylene-vinyl-acetate (LDPE/EVA) co-polymer film with 8% AEO significantly reduce the concentration of bacteria with inhibition strength of L. monocytogenes > B. thermosphacta > E. coli . For challenge test, the AM films sufficiently reduced the growth rate of L. monocytogenes on cooked beef at 4 °C. High amount of AEO only slightly weakens the mechanical properties whereby film crystallinity increases significantly when small amount of AEO incorporated. Industrial relevance The current innovation is applied for the meat industry where a prolong storage of meat is required. A. sativum extract is a natural essential oil which will not cause health risk when in contact with food when applied in the packaging.

Germination and Root Elongation Bioassays in Six Different Plant Species for Testing Ni Contamination in Soil

Abstract: In vitro short-term chronic phytotoxicity germination and root elongation test were applied to test the effects of nickel (Ni) in seed germination and root elongation in six plants species: Cucumis sativus (Cucurbitaceae), Lepidium sativum and Brassica nigra (Brassicaceae), Trifolium alexandrinum and Medicago sativa (Fabaceae), Phacelia tanacetifolia (Boraginaceae). A naturally Ni rich soil was used to compare the results obtained. Unlike root elongation, germination was not affected by Ni in any of the six species tested. EC50 values, calculated on the root elongation, showed that Ni toxicity decreases in the following order: P. tanacetifolia > B. nigra > C. sativus > L. sativum > M. sativa > T. alexandrinum. The test conducted using soil elutriate revealed a significantly lower effect in both seed germination and root elongation when compared to the results obtained using untreated soil. Conversely, the test performed on soil confirmed the high sensitivity of C. sativus, P. tanacetifolia and L. sativum to Ni.

Polyacetylene and carotenes from petroselinum sativum root

Abstract: Polyacetylenes, carotenes and other components such as starch, pectin, cellulose, lignin were investigated in the root of Petroselinum sativum by a noninvasive spectroscopic method. The components were measured in situ, directly in the plant tissue, with no preliminary sample preparation. The analysis was done on the basis of intensity of characteristic bands observed in Raman spectrum. The principal polyacetylenes from P. sativum are all–cis–polyacetylene (C2H2)n and all–trans–polyacetylene (C2H2)n have similar molecular structure, but present in their spectra a change of the symmetric group – C=C–C=C– from 2210 cm–¹ to 2002 cm–¹. The differences observed can be due both to the conformational differences and those existing in the environment. By Raman quantification were detected polyacetylenes that visualize the distribution of biostructures between the sections in root of P. sativum. The technique of quantification was applied to evaluate the distribution of some compounds such as lignin and polyglucides. Results showed an internal tissue specific accumulation in starch and biostructures like lignin, pectin and cellulose in the cell wall.

Antileishmanial activity of a mixture of Tridax procumbens and Allium sativum in mice

Abstract: We tested a mixture of Tridax procumbens, known for its direct action against Leishmania mexicana, and Allium sativum, known for its immunomodulatory effect, as an alternative to treat cutaneous leishmaniasis. Acute oral toxicity was tested with the Up-and-Down Procedure (UDP) using a group of healthy mice administered with either T. procumbens or A. sativum extracts and compared with a control group. Liver injury and other parameters of toxicity were determined in mice at day 14. The in vivo assay was performed with mice infected with L. mexicana promastigotes and treated with either a mixture of T. procumbens and A. sativum or each extract separately. The thickness of the mice's footpads was measured weekly. After the 12-week period of infection, blood samples were obtained by cardiac puncture to determine the total IgG, IgG1 and IgG2a immunoglobulins by a noncommercial indirect ELISA. We showed that the mixture of T. procumbens and A. sativum extracts was better at controlling L. mexicana infection while not being toxic when tested in the acute oral toxicity assay in mice. An increase in the ratio of IgG2a/IgG1 indicated a tendency to raise a Th1-type immune response in mice treated with the mixture. The mixture of T. procumbens and A. sativum extracts is a promising natural treatment for cutaneous leishmaniasis and its healing effects make it a good candidate for a possible new phytomedicine.

Influence of Inorganic Phosphorus, VAM Fungi, and Irrigation Regimes on Crop Productivity and Phosphorus Transformations in Okra (Abelmoschus esculentus L.)–Pea (Pisum sativum L.) Cropping System in an Acid Alfisol

Abstract: The present investigation was carried out at CSK Himachal Pradesh Agricultural University, Palampur, India, during 2009–2011 to economize inorganic phosphorus (P) and water needs of an okra (Abelmoschus esculentus)–pea (Pisum sativum) cropping system through vesicular arbuscular mycorrhizal (VAM) fungi (Glomus mosseae) in a Himalayan acid Alfisol. The field experiment was replicated three times in a randomized block design comprising 14 treatments consisting of 12 treatment combinations of two VAM levels [0 and 12 kg ha−1], three phosphorus levels [50, 75, and 100% of recommended soil-test-based nitrogen (N)–P–potassium (K)], and two irrigation regimes [40 and 80% of available water-holding capacity of field soil (AWC)], in addition to one treatment with “generalized recommended NPK dose with generalized recommended irrigations (GRD)” and one treatment based on “farmers’ practice of plant nutrition and irrigation management in the region.” This article presents crop productivity and P dynamics studies dur...

Erwinia persicina, a possible new necrosis and wilt threat to forage or grain legumes production

Abstract: Erwinia persicina (Ep) is a phytopathogenic bacteria found on Medicago sativa, Glycine max, Phaseolus vulgaris and Pisum sativum. It has also been isolated from healthy tomato, cucumber, banana, apple and pear, as well as the human urinary tract and biofilms located on paleolithic rock paintings. The host range and environmental adaptation capacity of Ep, and its life cycle on the lucerne plant, was studied. It was found that an Ep infection, which could be transmitted by seeds, water, and soil, caused necrosis and wilting of the whole mature lucerne plant. Subsequently, 15 genera and 22 species of forage or grain legumes were chosen to determine the pathogenicity of Ep. Among them were 11 genera and 19 species (e.g., Vigna angularis, Arachis hypogaea, Onobrychis viciaefolia, Astragalus adsurgens, etc.) reported as new hosts. The environmental adaptation capacity of Ep indicated its probable survival within a wide range of environmental conditions and an ability to endure arid, saline and alkaline environments. Based on the results of the life cycle, host range and environmental adaptation capacity of Ep, it was concluded that Ep could pose a new threat to forage or grain legumes production within farming systems.

Hydroalcoholic seed extract of Coriandrum sativum (Coriander) alleviates lead-induced oxidative stress in different regions of rat brain.

Abstract: Lead exposure is known to cause apoptotic neurodegeneration and neurobehavioral abnormalities in developing and adult brain by impairing cognition and memory. Coriandrum sativum is an herb belonging to Umbelliferae and is reported to have a protective effect against lead toxicity. In the present investigation, an attempt has been made to evaluate the protective activity of the hydroalcoholic extract of C. sativum seed against lead-induced oxidative stress. Male Wistar strain rats (100–120 g) were divided into four groups: control group: 1,000 mg/L of sodium acetate; exposed group: 1,000 mg/L lead acetate for 4 weeks; C. sativum treated 1 (CST1) group: 250 mg/kg body weight/day for seven consecutive days after 4 weeks of lead exposure; C. sativum treated 2 (CST2) group: 500 mg/kg body weight/day for seven consecutive days after 4 weeks of lead exposure. After the exposure and treatment periods, rats were sacrificed by cervical dislocation, and the whole brain was immediately isolated and separated into four regions: cerebellum, hippocampus, frontal cortex, and brain stem along with the control group. After sacrifice, blood was immediately collected into heparinized vials and stored at 4 °C. In all the tissues, reactive oxygen species (ROS), lipid peroxidation products (LPP), and total protein carbonyl content (TPCC) were estimated following standard protocols. An indicator enzyme for lead toxicity namely delta-amino levulinic acid dehydratase (δ-ALAD) activity was determined in the blood. A significant (p < 0.05) increase in ROS, LPP, and TPCC levels was observed in exposed rat brain regions, while δ-ALAD showed a decrease indicating lead-induced oxidative stress. Treatment with the hydroalcoholic seed extract of C. sativum resulted in a tissue-specific amelioration of oxidative stress produced by lead.

Phenolic content and antioxidant capacity of extracts of Laurus nobilis L., Coriandrum sativum L. and Amaranthus hybridus L.

Abstract: Extraction of polyphenols of Laurus nobilis L. (Lauraceae), Coriandrum sativum L. (Apiaceae) and Amaranthus hybridus L. (Amaranthaceae) was carried out by solid–liquid extraction. The effect of ethanol concentration and the extraction time were determined to obtain the maximum of polyphenols. Three different methods, DPPH radical scavenging, ABTS radical cation scavenging and lipid oxidation inhibition, were tested to determine the antioxidant capacity in the extracts. The results indicate that L. nobilis has a high antioxidant potential: 94.73%, 47.71% and 76.86% for DPPH, ABTS and lipid oxidation inhibition, respectively. On the other hand, C. sativum and A. hybridus showed 13.69% and 10.16% in DPPH assay, and 9.22% and 14.96% in ABTS assay, while it did not show any antioxidant capacity in the lipid oxidation inhibition method under the experimental conditions. In addition, the phenolic compounds in the extracts were also characterized by High Performance Liquid Chromatography (HPLC) analysis.

Pretreatment of Cr(VI)-Amended Soil With Chromate-Reducing Rhizobacteria Decreases Plant Toxicity and Increases the Yield of Pisum sativum

Abstract: Pot culture experiments were performed under controlled greenhouse conditions to investigate whether four Cr(VI)-reducing bacterial strains (SUCR44, SUCR140, SUCR186, and SUCR188) were able to decrease Cr toxicity to Pisum sativum plants in artificially Cr(VI)-contaminated soil. The effect of pretreatment of soil with chromate-reducing bacteria on plant growth, chromate uptake, bioaccumulation, nodulation, and population of Rhizobium was found to be directly influenced by the time interval between bacterial treatment and seed sowing. Pretreatment of soil with SUCR140 (Microbacterium sp.) 15 days before sowing (T+15) showed a maximum increase in growth and biomass in terms of root length (93 %), plant height (94 %), dry root biomass (99 %), and dry shoot biomass (99 %). Coinoculation of Rhizobium with SUCR140 further improved the aforementioned parameter. Compared with the control, coinoculation of SUCR140+R showed a 117, 116, 136, and 128 % increase, respectively, in root length, plant height, dry root biomass, and dry shoot biomass. The bioavailability of Cr(VI) decreased significantly in soil (61 %) and in uptake (36 %) in SUCR140-treated plants; the effects of Rhizobium, however, either alone or in the presence of SUCR140, were not significant. The populations of Rhizobium (126 %) in soil and nodulation (146 %) in P. sativum improved in the presence of SUCR140 resulting in greater nitrogen (54 %) concentration in the plants. This study shows the usefulness of efficient Cr(VI)-reducing bacterial strain SUCR140 in improving yields probably through decreased Cr toxicity and improved symbiotic relationship of the plants with Rhizobium. Further decrease in the translocation of Cr(VI) through improved nodulation by Rhizobium in the presence of efficient Cr-reducing bacterial strains could also decrease the accumulation of Cr in shoots.

First report of Phoma glomerata associated with the ascochyta blight complex on field pea (Pisum sativum) in Australia

Abstract: The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as "black spot disease" in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5'GTTTCCGTAGGTGAACCTGC 3') and AB28 (5'ATATGCTTAAGTTCAGCGGGT 3') were used to amplify extracted DNA from the 3' end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5' end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml-1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.

Wild peas vary in their cross-compatibility with cultivated pea (Pisum sativum subsp. sativum L.) depending on alleles of a nuclear-cytoplasmic incompatibility locus.

Abstract: Key message Divergent wild and endemic peas differ in hybrid sterility in reciprocal crosses with cultivated pea depending on alleles of a nuclear ‘speciation gene’ involved in nuclear–cytoplasmic compatibility.

In vitro free radical scavenging and DNA damage protective property of Coriandrum sativum L. leaves extract

Abstract: Coriandrum sativum L. (coriander), an everyday spice in the Indian kitchen is known to add flavor to the cuisine. It is an annual herb belonging to the Apiaceae (Umbellifera) family. The hydro-alcohol extract of Coriandrum sativum L. at the dose of 1 mg/ml was subjected to a series of in vitro assays viz. 2, 2′- diphenyl-1-picrylhydrazyl, lipid peroxidation by thiobarbituric acid, reducing power and nitric oxide (NO) radical scavenging in order to study its antioxidant efficacy in detail. The amount of flavonoids in 70% ethanol extract was found to be 44.5 μg and that of the total phenols was 133.74 μg gallic acid equivalents per mg extract. The extracts of the leaves showed metal chelating power, with IC50 values, 368.12 μg/ml where as that of standard EDTA was 26.7 μg/ml. The IC50 values for 2, 2′-azino-bis (3-ethylbenzothiazoline-6-sulphonic acid radical scavenging was 222 μg/ml where as that of standard ascorbic acid was 22.6 μg/ml. The NO scavenging activity of the extract of the leaves showed IC50 value of 815.6 μg/ml; at the same time the standard BHA had 49.1 μg/ml. All the plant extracts provided DNA damage protection; however, the protection provided at the dose of 8 μg/ml was comparable to that of standard gallic acid. The Coriandrum sativum leaf extract was able to prevent in vitro lipid peroxidation with IC50 values; 589.6 μg/ml where as that of standard BHA was 16.3 μg/ml. Our results also showed significant ferric reducing power indicating the hydrogen donating ability of the extract. This study indicated the potential of the leaf extract as a source of natural antioxidants or nutraceuticals that could be of use in food industry with potential application to reduce oxidative stress in living system.

Modulation in growth, photosynthetic efficiency, activity of antioxidants and mineral ions by foliar application of glycinebetaine on pea ( Pisum sativum L.) under salt stress

Abstract: A pot experiment was carried out to explore the role of glycinebetaine (GB) as foliar spray foliar on two pea (Pisum sativum L.) varieties (Pea 09 and Meteor Fsd) under saline and non-saline conditions. Thirty-two-day-old plants were subjected to two levels 0 and 150 mM of NaCl stress. Salt treatment was applied in full strength Hoagland’s nutrient solution. Three levels 0, 5 and 10 mM of GB were applied as foliar treatment on 34-day-old pea plants. After 2 weeks of foliar treatment with GB data for various growth and physiochemical attributes were recorded. Rooting-medium applied salt (150 mM NaCl) stress decreased growth, photosynthesis, chlorophyll, chlorophyll fluorescence and soluble protein contents, while increasing the activities of enzymatic (POD and CAT) and non-enzymatic (ascorbic acid and total phenolics) antioxidant enzymes. Foliar application of GB decreased root and shoot Na+ under saline conditions, while increasing shoot dry matter, root length, root fresh weight, stomatal conductance (g s), contents of seed ascorbic acid, leaf phenolics, and root and shoot Ca2+ contents. Of three GB (0, 5, 10 mM) levels, 10 mM proved to be more effective in mitigating the adverse effects of salinity stress. Overall, variety Pea 09 showed better performance in comparison to those of var. Meteor Fsd under both normal and salinity stress conditions. GB-induced modulation of seed ascorbic acid, leaf phenolics, g s, and root Ca2+ values might have contributed to the increased plant biomass, reduction of oxidative stress, increased osmotic adjustment and better photosynthetic performance of pea plants under salt stress.

Preliminary studies on phytochemicals and antimicrobial activity of solvent extracts of Coriandrum sativum L. roots(Coriander)

Abstract: The ethanol extraction of roots of the fresh Coriandrum Sativum were screened for the presence of various phytochemicals by standard procedures. The present study indicates that the fresh roots contain alkaloids, flavonoids, terpenoids, sterols, carbohydrates, saponins and phenolic compounds. The ethanol extract of roots was found to be exhibit Staphylococcus aureus, Bacillus cereus, Salmonella typhi, Klebsiella and Candida. The extract and fractionates of fresh roots of Coriandrum sativum showed a significant and remarkable activity against Staphylococcus aureus, Bacillus cereus, Salmonella typhi, Klebsiella, when compared to standard. The present work shows the presence of these biologically active chemical in Coriandrum Sativum may justify their wide usage in traditional medicine.

Insecticidal activity of turmeric (Curcuma longa) and garlic (Allium sativum) extracts against red flour beetle, Tribolium castaneum:A safe alternative to insecticides in stored commodities

Abstract: Study was aimed at the use of indigenous medicinal plants to check the invasion of red flour beetle, Tribolium castaneum (Herbst) against wheat grains. Acetone leaf extracts of turmeric (Curcuma longa) and garlic (Allium sativum) were used to evaluate their antifedant, toxicant, and growth regulatory effects against adults of T. castaneum. Four concentrations (5, 10, 15 and 20 %) of each extractalong-with a control treatment with five replications were applied. Thirty adults of T. castaneum were subjected to different treatments. Results painted that percent mortality was directly proportional to increasing concentration of extracts. Both A. sativum and C. longa significantly reduced the larval, pupal and adult emergence as well as percent weight loss (at α 5%) but A. sativum performed better as compared to the C. longa. Hence it can be concluded that both the botanicals can be used as effective tool against T. castaneum along-with other IPM tactics.

Biological activities of Allium sativum essential oil against pulse beetle, Callosobruchus chinensis (Coleoptera: Bruchidae)

Abstract: Essential oil from Allium sativum was isolated and investigated for its repellent, insecticidal, ovipositional and egg hatching inhibition activities against pulse beetle, Callosobruchus chinensis (Coleoptera: Bruchidae). A. sativum essential oil repelled bruchid adults at a very low concentration in choice oviposition assay. A. sativum essential oil caused both fumigant and contact toxicity in C. chinensis adults in a concentration dependent manner. Oviposition potency of C. chinensis adults was reduced significantly when sublethal concentrations of A. sativum essential oil were applied by fumigation and contact method. In chronic toxicity assay, A. sativum essential oil reduced F1 progeny emergence, damage and weight loss in seeds. Findings of the present study suggest that A. sativum essential oil can be useful as promising agent in insect pest management programme.

Experimental investigation on energy and exergy analysis of coriander (Coriadrum sativum L.) leaves drying in natural convection solar dryer

Abstract: This study deals with thin layer drying characteristics of Coriandrum sativum L. leaves in a natural convection solar dryer. The Coriandrum sativum L. leaves were dried from a moisture content of 88% (w.b.) to 4.5% (w.b.) in 7.5 hours. The obtained drying data were fitted to eight different drying kinetics models. Of these, the model suggested by Midilli et al. [20] had the best fit with the drying behavior of Coriandrum sativum L. leaves. In addition, the thermodynamic behaviour of a solar dryer was evaluated. The energy efficiency during the study varied from 7.81 to 37.93%. The exergy efficiency of the drying process ranged between 55.35 and 79.39%.

Evaluation of freshly prepared juice from garlic (Allium sativum L.) as a biopesticide against the maize weevil, Sitophilus zeamais (Motsch.) (Coleoptera: Curculionidae)

Abstract: Freshly prepared garlic (Allium sativum L.) juice, containing the antimicrobial allicin, was evaluated as a possible grain pro- tectant against the maize weevil, Sitophilus zeamais (Motsch.). Each experiment was set out in Completely Randomized Design (CRD) with four replications, and there was a control treatment. Adult mortality and weight loss percentage were investigated. There was an observed increase in adult mortality following days of exposure in all treatments. Statistically significant (p < 0.05) reduced grain loss was also observed in all the treatments when compared with the control. The juice samples were freshly prepared from an indigenous Nigerian garlic cultivar (GUN) and a cultivar purchased from a supermarket in Germany (GAG). These garlic juice samples exhibited lethal effects causing at least 90% adult mortality in contact toxicity tests. The amount of allicin in GUN was 1.88 mg/ml according to High Pressure Liquids Chromatography (HPLC) analysis, while the amount of allicin in GAG was 3.50 mg/ml. This study highlights the potential of A. sativum containing allicin for biorational control of maize grains against S. zeamais infestation and damage.

Fumigant, contact, and repellent activities of essential oils against the darkling beetle, Alphitobius diaperinus

Abstract: The fumigant, contact, and repellent activities of four essential oils extracted from Citrus limonum (Sapindales: Rutaceae), Litsea cubeba (Laurales: Lauraceae), Cinnamomum cassia, and Allium sativum L. (Asparagales: Alliaceae) against 6th instars and adults of the darkling beetle, Alphitobius diaperinus (Panzer) (Coleoptera: Tenebrionidae), one of the main pests of materials and products of Juncus effuses L. (Poales: Juncaceae) during the storage period, were assayed, and chemical ingredients were analyzed with gas chromatography-mass spectrometry in this study. While the major ingredients found in C. limonum and C. cassia were limonene and (E)- cinnamaldehyde, the main constituents of L. cubea were D-limonene, (E)-3,7- dimethyl-,2,6- octadienal, (Z)-3,7- dimethyl- ,2 ,6- octadienal, and diallyl disulphide (18.20%), while the main constituents of and A. sativum were di-2-propenyl trisulfide and di-2- propenyl tetrasulfide. The fumigation activities of A. sativum and C. limonum on A. diaperinus adults were better than those of the other two essential oilss. The toxicities of A. sativum and C. limonum were almost equitoxic at 96 hr after treatment. Essential oils from Allium sativum and L. cubeba also showed good contact activities from 24 hr to 48 hr, and toxicities were almost equitoxic 48 hr post-treatment. The repellent activities of A. sativum and L. cubeba oils on 6th instars were also observed, showing repellence indexes of 90.4% and 88.9% at 12 hr after treatment, respectively. The effects of A. sativum on AChE activity of 6th instars of A. diaperinus were strongest compared to the other essential oils, followed by C. limonum, L. cubeba, and C. cassia. These results suggest that the essential oils of C. limonum and A. sativum could serve as effective control agents of A. diaperinus.