Institution
Hallym University
Education•Chuncheon, South Korea•
About: Hallym University is a education organization based out in Chuncheon, South Korea. It is known for research contribution in the topics: Population & Medicine. The organization has 10605 authors who have published 18891 publications receiving 302498 citations.
Topics: Population, Medicine, Cancer, Stroke, Odds ratio
Papers published on a yearly basis
Papers
More filters
••
TL;DR: The cause of seasonal failure of a nitrifying municipal landfill leachate treatment plant utilizing a fixed biofilm was investigated by wastewater analyses and batch respirometric tests at every treatment stage and high free ammonia (NH3-N) inhibited not only nitrite oxidizing bacteria (NOB) but also ammonia oxidizingacteria (AOB).
389 citations
••
TL;DR: This Review presents the current knowledge on the physiology of irisin and its role in glucose homeostasis, and describes the mechanisms involved in the synthesis, secretion, circulation and regulation of irisin, and the controversies regarding the measurement.
Abstract: Irisin is a myokine that leads to increased energy expenditure by stimulating the 'browning' of white adipose tissue. In the first description of this hormone, increased levels of circulating irisin, which is cleaved from its precursor fibronectin type III domain-containing protein 5, were associated with improved glucose homeostasis by reducing insulin resistance. Consequently, several studies attempted to characterize the role of irisin in glucose regulation, but contradictory results have been reported, and even the existence of this hormone has been questioned. In this Review, we present the current knowledge on the physiology of irisin and its role in glucose homeostasis. We describe the mechanisms involved in the synthesis, secretion, circulation and regulation of irisin, and the controversies regarding the measurement of irisin. We also discuss the direct effects of irisin on glucose regulatory mechanisms in different organs, the indirect effects and interactions with other hormones, and the important open questions with regard to irisin in those organs. Finally, we present the results from animal interventional studies and from human clinical studies investigating the association of irisin with obesity, insulin resistance, type 2 diabetes mellitus and the metabolic syndrome.
383 citations
••
TL;DR: Results indicate that S1P induces angiogenesis predominantly via G(i) protein-coupled receptors in endothelial cells and suggest that S 1P may act as an important modulator of platelet-induced angiogenicity.
376 citations
••
Vanderbilt University1, Hallym University2, Imperial College London3, Agency for Science, Technology and Research4, Harvard University5, China Medical University (Taiwan)6, Academia Sinica7, University of Tokyo8, Ehime University9, Peking Union Medical College10, Shanghai Jiao Tong University11, University of Southern California12, Guangxi Medical University13, National University of Singapore14, Southeast University15, Tulane University16, University of Hawaii17, Singapore National Eye Center18, University of Melbourne19, Kyushu University20, Wake Forest University21, Centers for Disease Control and Prevention22, Aichi Gakuin University23, University of California, San Francisco24
TL;DR: A meta-analysis of associations between BMI and approximately 2.4 million SNPs in 27,715 east Asians and three additional loci nearly reached the genome-wide significance threshold may shed light on new pathways involved in obesity and demonstrate the value of conducting genetic studies in non-European populations.
Abstract: Multiple genetic loci associated with obesity or body mass index (BMI) have been identified through genome-wide association studies conducted predominantly in populations of European ancestry We performed a meta-analysis of associations between BMI and approximately 24 million SNPs in 27,715 east Asians, which was followed by in silico and de novo replication studies in 37,691 and 17,642 additional east Asians, respectively We identified ten BMI-associated loci at genome-wide significance (P < 50 × 10(-8)), including seven previously identified loci (FTO, SEC16B, MC4R, GIPR-QPCTL, ADCY3-DNAJC27, BDNF and MAP2K5) and three novel loci in or near the CDKAL1, PCSK1 and GP2 genes Three additional loci nearly reached the genome-wide significance threshold, including two previously identified loci in the GNPDA2 and TFAP2B genes and a newly identified signal near PAX6, all of which were associated with BMI with P < 50 × 10(-7) Findings from this study may shed light on new pathways involved in obesity and demonstrate the value of conducting genetic studies in non-European populations
374 citations
••
TL;DR: A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamyzin-immobilized sepharose beads and was detected down to 25 nM by the gold nanoparticle-based colorimetric method.
370 citations
Authors
Showing all 10682 results
Name | H-index | Papers | Citations |
---|---|---|---|
Christos S. Mantzoros | 124 | 712 | 55587 |
Pak H. Chan | 99 | 330 | 35997 |
Nosratola D. Vaziri | 98 | 708 | 34586 |
Christopher I. Shaffrey | 87 | 805 | 27862 |
Eric J. Jacobs | 86 | 263 | 23485 |
Hyun Lee | 83 | 512 | 52596 |
Amanda G. Thrift | 73 | 316 | 67787 |
Young-Min Kim | 71 | 1314 | 26916 |
Young-Bum Kim | 70 | 447 | 22433 |
William F. Fearon | 66 | 309 | 23956 |
Sung Hoon Noh | 62 | 440 | 15255 |
Hyo Keun Lim | 62 | 276 | 11816 |
Hyoung Gon Lee | 60 | 200 | 11773 |
Young Guen Kwon | 60 | 231 | 12379 |
Sin-Ho Jung | 56 | 317 | 12143 |