Showing papers by "University of Sydney published in 1999"

Distance‐based redundancy analysis: testing multispecies responses in multifactorial ecological experiments

Abstract: We present a new multivariate technique for testing the significance of individual terms in a multifactorial analysis-of-variance model for multispecies response variables. The technique will allow researchers to base analyses on measures of association (distance measures) that are ecologically relevant. In addition, unlike other distance-based hypothesis-testing techniques, this method allows tests of significance of interaction terms in a linear model. The technique uses the existing method of redundancy analysis (RDA) but allows the analysis to be based on Bray-Curtis or other ecologically meaningful measures through the use of principal coordinate analysis (PCoA). Steps in the procedure include: (1) calculating a matrix of distances among replicates using a distance measure of choice (e.g., Bray-Curtis); (2) determining the principal coordinates (including a correction for negative eigenvalues, if necessary), which preserve these distances; (3) creating a matrix of dummy variables corresponding to the design of the experiment (i.e., individual terms in a linear model); (4) analyzing the relationship between the principal coordinates (species data) and the dummy variables (model) using RDA; and (5) implementing a test by permutation for particular statistics corresponding to the particular terms in the model. This method has certain advantages not shared by other multivariate testing procedures. We demonstrate the use of this technique with experimental ecological data from intertidal assemblages and show how the presence of significant multivariate interactions can be interpreted. It is our view that distance-based RDA will be extremely useful to ecologists measuring multispecies responses to structured multifactorial experimental designs.

Epigenetic inheritance at the agouti locus in the mouse.

Abstract: Epigenetic modifications have effects on phenotype, but they are generally considered to be cleared on passage through the germ line in mammals, so that only genetic traits are inherited. Here we describe the inheritance of an epigenetic modification at the agouti locus in mice. In viable yellow ( Avy/a) mice, transcription originating in an intra-cisternal A particle (IAP) retrotransposon inserted upstream of the agouti gene ( A) causes ectopic expression of agouti protein, resulting in yellow fur, obesity, diabetes and increased susceptibility to tumours1. The pleiotropic effects of ectopic agouti expression are presumably due to effects of the paracrine signal on other tissues. Avy mice display variable expressivity because they are epigenetic mosaics for activity of the retrotransposon: isogenic Avy mice have coats that vary in a continuous spectrum from full yellow, through variegated yellow/agouti, to full agouti (pseudoagouti). The distribution of phenotypes among offspring is related to the phenotype of the dam; when an Avy dam has the agouti phenotype, her offspring are more likely to be agouti2,3. We demonstrate here that this maternal epigenetic effect is not the result of a maternally contributed environment. Rather, our data show that it results from incomplete erasure of an epigenetic modification when a silenced Avy allele is passed through the female germ line, with consequent inheritance of the epigenetic modification. Because retrotransposons are abundant in mammalian genomes, this type of inheritance may be common.

Archean molecular fossils and the early rise of eukaryotes

Abstract: Molecular fossils of biological lipids are preserved in 2700-million-year-old shales from the Pilbara Craton, Australia. Sequential extraction of adjacent samples shows that these hydrocarbon biomarkers are indigenous and syngenetic to the Archean shales, greatly extending the known geological range of such molecules. The presence of abundant 2α-methylhopanes, which are characteristic of cyanobacteria, indicates that oxygenic photosynthesis evolved well before the atmosphere became oxidizing. The presence of steranes, particularly cholestane and its 28- to 30-carbon analogs, provides persuasive evidence for the existence of eukaryotes 500 million to 1 billion years before the extant fossil record indicates that the lineage arose.

Drugs and Falls in Older People: A Systematic Review and Meta‐analysis: I. Psychotropic Drugs

Abstract: OBJECTIVES: To evaluate critically the evidence linking psychotropic drugs with falls in older people. DESIGN: Fixed-effects meta-analysis. DATA SOURCES: English-language articles in MEDLINE (1966 – March 1996) indexed under accidents or accidental falls and aged or age factors; bibliographies of retrieved papers. STUDY SELECTION: Systematic evaluation of sedative/hypnotic, antidepressant, or neuroleptic use with falling in people aged 60 and older. DATA EXTRACTION: Study design, inclusion and exclusion criteria, setting, sample size, response rate, mean age, method of medication verification and fall assessment, fall definition, and the number of fallers and non-fallers taking specific classes of psychotropic drugs. RESULTS: Forty studies, none randomized controlled trials, met eligibility criteria. For one or more falls, the pooled odds ratio (95% confidence interval) was 1.73 (95%CI, 1.52-1.97) for any psychotropic use; 1.50 (95%CI, 1.25-1.79) for neuroleptic use; 1.54 (95%CI, 1.40-1.70) for sedative/hypnotic use; 1.66 (95%CI, 1.4-1.95) for any antidepressant use (mainly TCAs); 1.51 (95%CI, 1.14-2.00) for only TCA use; and 1.48 (95%CI, 1.23-1.77) for benzodiazepine use, with no difference between short and long acting benzodiazepines. For neuroleptics in psychiatric inpatients, the pooled OR was 0.41 (95%CI, 0.21-.82); for all other patients, the pooled OR was 1.66 (95%CI, 1.38-2.00). Comparing ≥1 with ≥ 2 falls, mean subject age >75 versus ≥ 75 years old, communities with >35% versus ≥35% fallers, or subject place of residence did not affect the pooled OR. Increased falls occurred in patients taking more than one psychotropic drug. CONCLUSION: There is a small, but consistent, association between the use of most classes of psychotropic drugs and falls. The evidence to date, however, is based solely on observational data, with minimal adjustment for confounders, dosage, or duration of therapy. The incidence of falls and their consequences in this population necessitate that future large randomized controlled trials of any medication in older persons should measure falls prospectively as an adverse outcome event.

An evidence-based appraisal of reflux disease management — the Genval Workshop Report

Abstract: This report summarises conclusions from an evidence-based workshop which evaluated major clinical strategies for the management of the full spectrum of gastro-oesophageal reflux disease, with an emphasis on medical management. The disease was defined by the presence of oesophageal mucosal breaks or by the occurrence of reflux induced symptoms severe enough to impair quality of life. Endoscopy negative patients were recognised as the most common subgroup; most of these patients can be diagnosed by a well structured symptom analysis. There is a consistent hierarchy of effectiveness of available initial and long term therapies that applies for all patient subgroups. Lifestyle measures were judged to be of such low efficacy that they were rejected as a primary therapy for all patient subgroups. Proton pump inhibitor therapy was considered the initial medical treatment of choice because of its clearly superior efficacy which results in the most prompt achievement of desirable outcomes at the lowest overall medical cost. It was acknowledged that most of patients require long term management and that any maintenance therapy should be chosen by step down to the regimen that is still effective, but least costly. Endoscopic monitoring of routine long term therapy was considered inappropriate, on the basis that control of symptoms is an acceptably reliable indicator of healing in patients with oesophagitis. Laparoscopic antireflux surgery was recognised as a significant therapeutic advance, the results of which, however, depend substantially on the experience of the surgeon. There are currently no published direct comparisons of cost and efficacy outcomes of optimal medical and surgical therapies for reflux disease. To a significant degree, the choice between medical and surgical therapy should depend on informed patient preference. Substantial advances have occurred recently in the understanding and treatment of reflux disease. By contrast, there has been relatively little research into the best …

Drugs and Falls in Older People: A Systematic Review and Meta‐analysis: II. Cardiac and Analgesic Drugs

Abstract: OBJECTIVES: To evaluate critically the evidence linking specific classes of cardiac and analgesic drugs to falls in older people. DESIGN: Fixed-effects meta-analysis. DATA SOURCES: English-language articles in MEDLINE (1966 – March 1996) indexed under accidents or accidental falls and aged or age factors; bibliographies of retrieved papers. STUDY SELECTION: Systematic evaluation of cardiac or analgesic drug use and any fall in people aged 60 years and older. DATA EXTRACTION: Study design, inclusion and exclusion criteria, setting, sample size, response rate, mean age, method of medication verification and fall assessment, fall definition, and the number of fallers and nonfallers taking specific classes of cardiac and analgesic drugs. RESULTS: Twenty nine studies met inclusion criteria. None were randomized controlled trials. For one or more falls, the pooled Odds Ratio (95% Confidence Interval) was 1.08 (1.02-1.16) for diuretic use, 1.06 (0.97-1.16) for thiazide diuretics, 0.90 (0.73-1.12) for loop diuretics, 0.93 (0.77-1.11) for beta-blockers, 1.16 (0.87-1.55) for centrally acting antihypertensives, 1.20 (0.92-1.58) for ACE inhibitors, 0.94 (0.77-1.14) for calcium channel blockers, 1.13 (0.95-1.36) for nitrates, 1.59 (1.02-2.48) for type la antiarrhythmics, and 1.22 (1.05-1.42) for digoxin use. For analgesic drugs, the pooled OR was 0.97 (0.78-1.20) for narcotic use, 1.09 (0.88-1.34) for nonnarcotic analgesic use, 1.16 (0.97-1.38) for NSAID use, and 1.12 (0.80-1.57) for aspirin use. There was no statistically significant heterogeneity of pooled odds ratios. There were no differences between the pooled odds ratios for studies with mean subject age <75 versus ≥75 years old or for studies in communities with <35% versus ≥35% fallers. In studies of the relationship between psychotropic, cardiac, or analgesic drugs and falls, subjects reporting the use of more than three or four medications of any type were at increased risk of recurrent falls. CONCLUSION: Digoxin, type IA antiarrhythmic, and diuretic use are associated weakly with falls in older adults. No association was found for the other classes of cardiac or analgesic drugs examined. The evidence to date, however, is based solely on observational data, with minimal adjustment for confounders, dosage, or duration of therapy. Older adults taking more than three or four medications were at increased risk of recurrent falls. As a result of the incidence of falls and their consequences in this population, programs designed to decrease medication use should be evaluated for their impact on fall rates.

The orphan human pregnane X receptor mediates the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module.

Abstract: Cytochrome P-450 3A4 (CYP3A4), the predominant cytochrome P-450 expressed in adult human liver, is subject to transcriptional induction by a variety of structurally unrelated xenobiotics, including the antibiotic rifampicin. The molecular mechanisms underlying this phenomenon are poorly understood. We transfected a human liver-derived cell line (HepG2) with various CYP3A4 -luciferase reporter gene constructs containing a nested set of 5′-deletions of the CYP3A4 5′-flanking region. Rifampicin-inducible transcription of the reporter gene was observed only with the longest construct, which encompassed bases −13000 to +53 of CYP3A4 (3-fold induction). The responsive region was functional regardless of its position or orientation relative to the proximal promoter of CYP3A4 and was capable of conferring rifampicin-inducible expression on a heterologous promoter. Further deletion mutants localized the induction to bases −7836 to −7607. In vitro DNase I footprint analysis of this region revealed four protected sites (FP1, FP2, FP3, and FP4). Two of these sites, FP3 (bases −7738 to −7715) and FP4 (bases −7698 to −7682), overlapped binding motifs for the orphan human pregnane X receptor (hPXR). Cotransfection of responsive constructs with a hPXR expression vector substantially increased the rifampicin-inducibility to ∼50-fold. In addition, the rifampicin-responsive constructs were strongly activated by a range of CYP3A inducers. Finally, we demonstrate cooperativity between elements within the distal enhancer region and cis -acting elements in the proximal promoter of CYP3A4 . Our results provide evidence for the existence of a potent enhancer module, 8 kb distal to the transcription start point, which mediates the transcriptional induction of CYP3A4 by activators of hPXR.

Structural deficiencies in granuloma formation in TNF gene-targeted mice underlie the heightened susceptibility to aerosol Mycobacterium tuberculosis infection, which is not compensated for by lymphotoxin.

Abstract: TNF and lymphotoxin-alpha (LT alpha) may act at various stages of the host response to Mycobacterium tuberculosis. To dissect the effects of TNF independent of LT alpha, we have used C57BL/6 mice with a disruption of the TNF gene alone (TNF-/-). Twenty-one days following aerosol M. tuberculosis infection there was a marked increase in the number of organisms in the lungs of TNF-/- mice, and by 28-35 days all animals had succumbed, with widespread dissemination of M. tuberculosis. In comparison with the localized granulomas containing activated macrophages and T cells in lungs and livers of C57BL/6 wild-type (wt) mice, cellular infiltrates in TNF-/- mice were poorly formed, with extensive regions of necrosis and neutrophilic infiltration of the alveoli. Phenotypic analysis of lung homogenates demonstrated similar numbers of CD4+ and CD8+ T cells in TNF-/- and wt mice, but in TNF-deficient mice the lymphocytes were restricted to perivascular and peribronchial areas rather than colocated with macrophages in granulomas. T cells from TNF-/- mice retained proliferative and cytokine responses to purified protein derivative, and delayed-type hypersensitivity to purified protein derivative was demonstrable. Macrophages within the lungs of TNF-/- and wt mice showed similar levels of MHC class II and inducible nitric oxide synthase expression, and levels of serum nitrite were comparable. Thus, the enhanced susceptibility of TNF-/- is not compensated for by the presence of LT alpha, and the critical role of TNF is not in the activation of T cells and macrophages but in the local organization of granulomas.

Restoration of an inbred adder population

Abstract: The negative effects of inbreeding on population size are well documented in captive animals1, but there is surprisingly little evidence that genetic factors cause a decline in wild populations2,3, apart from a reported correlation of low levels of genetic variability with a high incidence of malformed or stillborn offspring4. From the point of view of conservation strategies, it is not only the effect of genetic factors on population decline that needs to be considered, but also whether introducing novel genes can prevent or reverse such a decline. Here we show that the introduction of new genes into a severely inbred and isolated population of adders (Vipera berus) halted its precipitous decline towards extinction and expanded the population dramatically.

Home visits by an occupational therapist for assessment and modification of environmental hazards: a randomized trial of falls prevention.

Abstract: OBJECTIVE: To determine whether occupational therapist home visits targeted at environmental hazards reduce the risk of falls DESIGN: A randomized controlled trial SETTING: Private dwellings in the community in Sydney, Australia PARTICIPANTS: A total of 530 subjects (mean age 77 years), recruited primarily before discharge from selected hospital wards INTERVENTION: A home visit by an experienced occupational therapist, who assessed the home for environmental hazards and facilitated any necessary home modifications MEASUREMENTS: The primary study outcome was falls, ascertained over a 12-month follow-up period using a monthly falls calendar RESULTS: Thirty six percent of subjects in the intervention group had at least one fall during follow-up, compared with 45% of controls (P = 050) The intervention was effective only among subjects (n = 206) who reported having had one or more falls during the year before recruitment into the study; in this group, the relative risk of at least one fall during follow-up was 064 (95% confidence interval, 050-083) Similar results were obtained when falls data were analyzed using survival analysis techniques (proportional and multiplicative hazards models) and fall rates (mean number of falls per person per year) About 50% of the recommended home modifications were in place at a 12-month follow-up visit CONCLUSIONS: Home visits by occupational therapists can prevent falls among older people who are at increased risk of falling However, the effect may not be caused by home modifications alone Home visits by occupational therapists may also lead to changes in behavior that enable older people to live more safely in both the home and the external environment J Am Geriatr Soc 47:1397–1402, 1999

A recursive technique for tracking control of nonholonomic systems in chained form

Abstract: The authors address the tracking problem for a class of nonholonomic chained form control systems. A recursive technique is proposed which appears to be an extension of the currently popular integrator backstepping idea to the tracking of nonholonomic control systems. Conditions are given under which the problems of semiglobal tracking and global path-following are solved for a nonholonomic system in chained form and its dynamic extension. Results on local exponential tracking are also obtained. Two physical examples of an articulated vehicle and a knife edge are provided to demonstrate the effectiveness of our algorithm through simulations.

SUMSS: A Wide-Field Radio Imaging Survey of the Southern Sky. I. Science Goals, Survey Design, and Instrumentation

Abstract: The Molonglo Observatory Synthesis Telescope, operating at 843 MHz with a 5 deg2 field of view, is carrying out a radio imaging survey of the sky south of declination -30°. This survey (the Sydney University Molonglo Sky Survey, or SUMSS) produces images with a resolution of 43'' × 43'' csc |δ| and an rms noise level of ~1 mJy beam-1. The SUMSS is therefore similar in sensitivity and resolution to the northern NRAO VLA Sky Survey. The survey is progressing at a rate of about 1000 deg2 per year, yielding individual and statistical data for many thousands of weak radio sources. This paper describes the main characteristics of the survey and presents sample images from the first year of observations.

Skeletal muscle hypertrophy is mediated by a Ca2+-dependent calcineurin signalling pathway.

Abstract: Skeletal muscle hypertrophy and regeneration are important adaptive responses to both physical activity and pathological stimuli1 Failure to maintain these processes underlies the loss of skeletal muscle mass and strength that occurs with ageing and in myopathies2 Here we show that stable expression of a gene encoding insulin-like growth factor 1 (IGF-1) in C2C12 skeletal muscle cells, or treatment of these cells with recombinant IGF-1 or with insulin and dexamethasone, results in hypertrophy of differentiated myotubes and a switch to glycolytic metabolism Treatment with IGF-1 or insulin and dexamethasone mobilizes intracellular calcium, activates the Ca2+/calmodulin-dependent phosphatase calcineurin, and induces the nuclear translocation of the transcription factor NF-ATc1 Hypertrophy is suppressed by the calcineurin inhibitors cyclosporin A or FK506, but not by inhibitors of the MAP-kinase or phosphatidylinositol-3-OH kinase pathways Injecting rat latissimus dorsi muscle with a plasmid encoding IGF-1 also activates calcineurin, mobilizes satellite cells and causes a switch to glycolytic metabolism We propose that growth-factor-induced skeletal-muscle hypertrophy and changes in myofibre phenotype are mediated by calcium mobilization and are critically regulated by the calcineurin/NF-ATc1 signalling pathway

A high integrity IMU/GPS navigation loop for autonomous land vehicle applications

Abstract: This paper describes the development and implementation of a high integrity navigation system, based on the combined use of the Global Positioning System (GPS) and an inertial measurement unit (IMU), for autonomous land vehicle applications. The paper focuses on the issue of achieving the integrity required of the navigation loop for use in autonomous systems. The paper highlights the detection of possible faults both before and during the fusion process in order to enhance the integrity of the navigation loop. The implementation of this fault detection methodology considers both low frequency faults in the IMU caused by bias in the sensor readings and the misalignment of the unit, and high frequency faults from the GPS receiver caused by multipath errors. The implementation, based on a low-cost, strapdown IMU, aided by either standard or carrier phase GPS technologies, is described. Results of the fusion process are presented.

Handgrip strength testing: A review of the literature

Abstract: Testing grip strength is a popular assessment used by occupational therapists in a range of clinical settings. It is fast, easy to perform, reliable and produces a result which is simple to record. Results of grip strength testing have been used to determine a baseline measure of performance against which change can be compared, as well as comparison of results to normative data. This article reviews the literature associated with the measurement of grip strength. It addresses the purposes of grip strength measurement; the instruments used and their reliability and accuracy; the testing position and protocol suggested for use and aspects of these which may influence results; the use of normative data and factors which influence grip strength, including age, gender and occupation; and various methods to determine level or sincerity of effort. Recommendations are made regarding these issues to enable clinicians to conduct grip strength assessments and interpret the results with confidence.

Iwahori-Hecke Algebras and Schur Algebras of the Symmetric Group

Abstract: The Iwahori-Hecke algebra of the symmetric group Cellular algebras The modular representation theory of $\mathcal {H}$ The $q$-Schur algebra The Jantzen sum formula and the blocks of $\mathcal H$ Branching rules, canonical bases and decomposition matrices Appendix A. Finite dimensional algebras over a field Appendix B. Decomposition matrices Appendix C. Elementary divisors of integral Specht modules Index of notation References Index.

The 'ABC' of GABA receptors: a brief review.

Abstract: 1. In the mammalian central nervous system, GABA is the main inhibitory neurotransmitter. GABA is a highly flexible molecule and, thus, can exist in many low-energy conformations. Conformationally restricted analogues of GABA have been used to help identify three major GABA receptors, termed GABAA, GABAB and GABAC receptors. 2. GABAA and GABAC receptors are members of a super-family of transmitter-gated ion channels that include nicotinic acetylcholine, strychnine-sensitive glycine and 5HT3 receptors. GABAA receptors are hetero-oligomeric Cl- channels that are selectively blocked by the alkaloid bicuculline and modulated by steroids, barbiturates and benzodiazepines. To date, 16 human GABAA receptor cDNA have been cloned. 3. GABAB receptors are seven transmembrane receptors that are coupled to G-proteins and activate second messenger systems and Ca2+ and K+ ion channels. To date, three GABAB receptor proteins have been cloned and these resemble metabotropic glutamate receptors. GABAB receptors are hetero-oligomeric receptors made up of a mixture of a combination of the subunits. These receptors are selectively activated by (-)-baclofen and CCGP27492 and are blocked by phaclofen, the phosphonic acid analogue of baclofen. 4. In contrast, GABAC receptors represent a relatively simple form of transmitter-gated Cl- channel made up of a single type of protein subunit. Two human GABAC receptor cDNA have been cloned. These receptors are not blocked by bicuculline nor are they modulated by steroids, barbiturates or benzodiazepines. Instead, GABAC receptors are selectively activated by the conformationally restricted analogues of GABA in the folded conformation cis-4-aminocrotonic acid and (1s,2R)-2-(aminomethyl)-1-carboxycyclopropane. (1,2,5,6-Tetrahydropyridine-4-yl)methylphosphinic acid, a methylphosphinic acid analogue of GABA in a partially folded conformation, is a selective antagonist at GABAC receptors.

An empirical comparison of permutation methods for tests of partial regression coefficients in a linear model

Abstract: This study compared empirical type I error and power of different permutation techniques for the test of significance of a single partial regression coefficient in a multiple regression model, using simulations. The methods compared were permutation of raw data values, two alternative methods proposed for permutation of residuals under the reduced model, and permutation of residuals under the full model. The normal-theory t-test was also included in simulations. We investigated effects of (1) the sample size, (2) the degree of collinearity between the predictor variables, (3) the size of the covariable’s parameter, (4) the distribution of the added random error and (5) the presence of an outlier in the covariable on these methods. We found that two methods that had been identified as equivalent formulations of permutation under the reduced model were actually quite different. One of these methods resulted in consistently inflated type 1 error. In addition, when the covariable contained an extreme outlier,...

Mutations in the skeletal muscle α-actin gene in patients with actin myopathy and nemaline myopathy

Abstract: Muscle contraction results from the force generated between the thin filament protein actin and the thick filament protein myosin, which causes the thick and thin muscle filaments to slide past each other. There are skeletal muscle, cardiac muscle, smooth muscle and non-muscle isoforms of both actin and myosin. Inherited diseases in humans have been associated with defects in cardiac actin (dilated cardiomyopathy and hypertrophic cardiomyopathy), cardiac myosin (hypertrophic cardiomyopathy) and non-muscle myosin (deafness). Here we report that mutations in the human skeletal muscle alpha-actin gene (ACTA1) are associated with two different muscle diseases, 'congenital myopathy with excess of thin myofilaments' (actin myopathy) and nemaline myopathy. Both diseases are characterized by structural abnormalities of the muscle fibres and variable degrees of muscle weakness. We have identified 15 different missense mutations resulting in 14 different amino acid changes. The missense mutations in ACTA1 are distributed throughout all six coding exons, and some involve known functional domains of actin. Approximately half of the patients died within their first year, but two female patients have survived into their thirties and have children. We identified dominant mutations in all but 1 of 14 families, with the missense mutations being single and heterozygous. The only family showing dominant inheritance comprised a 33-year-old affected mother and her two affected and two unaffected children. In another family, the clinically unaffected father is a somatic mosaic for the mutation seen in both of his affected children. We identified recessive mutations in one family in which the two affected siblings had heterozygous mutations in two different exons, one paternally and the other maternally inherited. We also identified de novo mutations in seven sporadic probands for which it was possible to analyse parental DNA.

A common nonsense mutation results in alpha-actinin-3 deficiency in the general population.

Abstract: T he α-actinins are actin-binding proteins encoded by a multigene family. In skeletal muscle, they are a major structural component of the Z-lines that anchor the actin-containing thin filaments and maintain the spatial relationship between myofilaments 1. In humans, two genes (ACTN2 and ACTN3) encode the closely related α-actinin-2 and α-actinin-3 skeletal muscle iso-forms 2. ACTN2 is expressed in all skeletal muscle fibres, whereas expression of ACTN3 is limited to a subset of type 2 (fast) fibres 3. We have previously demonstrated absence of α-actinin-3 in muscle biopsies from several patients with muscular dystrophy 3. A follow-up study identified additional α-actinin-3−negative biopsies from neuromuscular patients with other known diseases, suggesting that this deficiency was not the primary cause of muscle weakness 4. Subsequently, we screened muscle specimens with dys-trophic (118 specimens), myopathic (74), neurogenic (20) and normal (55) features (Fig. 1a−d). Although these biopsies contained normal α-actinin-2 expression, deficiency of α-actinin-3 was identified by immunocytochemistry and western blot in 51 of 267 cases (19%), a finding not associated with any particular histo-pathological or clinical phenotype. To ascertain whether α-actinin-3 deficiency was associated with mutations of ACTN3, we used an RT-PCR approach to amplify mRNA isolated from diagnostic muscle biopsies. Using primer pairs AB16/AB9 (5´–GATGGTTATGCAGCCCGAGG–3ánd 5´–AGCAACGCCCGCACCTCCT–3´) and AB8/AB1 (5´–TGCACGAAGCCTG-GACCC–3ánd 5´–AGAGAGGGATCTT-TATTCAG–3´), we PCR-amplified two overlapping fragments encompassing bases 24−2,852 of ACTN3 mRNA (ref. 2). Initially, we focused on one family with two affected male siblings with congenital muscular dystrophy and complete deficiency of α-actinin-3. Sequencing of ACTN3 cDNA from the proband identified two changes relative to controls and the previously determined sequence M86407. These were an A→G transition at nt 1,586 in exon 15, changing a gluta-mine (CAG) to an arginine (CGG) at residue 523 (Q523R), and a C→T trans-version at position 1,747 in exon 16, converting an arginine to a stop codon at residue 577 (R577X; Fig. 1e−g). Direct sequencing of genomic DNA from the proband and the affected sibling confirmed homozygosity for both point mutations. Subsequent testing of the parents and two unaffected siblings revealed that these phenotypically normal individuals had the same genotype as the proband and were thus homozygous for the ACTN3 577X nonsense mutation. The R577X change creates a novel DdeI site (Fig. 1h). An additional 125 biopsies for which matched DNA samples were available were tested for α-actinin-3 expression and ACTN3 genotype (48 α-actinin-3−deficient and 77 α-actinin-3− positive biopsies with a mixture of histological and clinical …

Early events in stretch-induced muscle damage.

Abstract: Unaccustomed exercise involving stretch of active muscle at long length causes an immediate loss of tension-generating capacity, a shift of optimum length, and changes in excitation-contraction cou...