scispace - formally typeset
Open AccessJournal ArticleDOI

Stage of perinatal development regulates skeletal muscle mitochondrial biogenesis and myogenic regulatory factor genes with little impact of growth restriction or cross-fostering.

Reads0
Chats0
TLDR
It appears that reductions in adult mitochondrial biogenesis markers likely develop after weaning, as developmental age appears to be a major factor regulating skeletal muscle mitochondrial and developmental genes, with growth restriction and cross-fostering having only subtle effects.
Abstract
Foetal growth restriction impairs skeletal muscle development and adult muscle mitochondrial biogenesis. We hypothesized that key genes involved in muscle development and mitochondrial biogenesis would be altered following uteroplacental insufficiency in rat pups, and improving postnatal nutrition by cross-fostering would ameliorate these deficits. Bilateral uterine vessel ligation (Restricted) or sham (Control) surgery was performed on day 18 of gestation. Males and females were investigated at day 20 of gestation (E20), 1 (PN1), 7 (PN7) and 35 (PN35) days postnatally. A separate cohort of Control and Restricted pups were cross-fostered onto a different Control or Restricted mother and examined at PN7. In both sexes, peroxisome proliferator-activated receptor (PPAR)-γ coactivator-1α (PGC-1α), cytochrome c oxidase subunits 3 and 4 (COX III and IV) and myogenic regulatory factor 4 expression increased from late gestation to postnatal life, whereas mitochondrial transcription factor A, myogenic differentiation 1 (MyoD), myogenin and insulin-like growth factor I (IGF-I) decreased. Foetal growth restriction increased MyoD mRNA in females at PN7, whereas in males IGF-I mRNA was higher at E20 and PN1. Cross-fostering Restricted pups onto a Control mother significantly increased COX III mRNA in males and COX IV mRNA in both sexes above controls with little effect on other genes. Developmental age appears to be a major factor regulating skeletal muscle mitochondrial and developmental genes, with growth restriction and cross-fostering having only subtle effects. It therefore appears that reductions in adult mitochondrial biogenesis markers likely develop after weaning.

read more

Content maybe subject to copyright    Report

Deakin Research Online
This is the published version:
Laker, R. C., Wadley, G. D., McConell, G. K. and Wlodek, M. E. 2012, Stage of perinatal
development regulates skeletal muscle mitochondrial biogenesis and myogenic regulatory
factor genes with little impact of growth restriction or cross-fostering, Journal of
development origins of health and disease, vol. 3, no. 1, pp. 39-51
Available from Deakin Research Online:
http://hdl.handle.net/10536/DRO/DU:30046181
Reproduced with the kind permission of the copyright owner.
Copyright : 2011, Cambridge University Press and the International Society for
Developmental Origins of Health and Disease

Journal of Developmental Origins of Health and Disease (2012), 3(1), 39–51.
& Cambridge University Press and the International Society for Developmental Origins of Health and Disease 2011
doi:10.1017/S204017441100064X
ORIGINAL ARTICLE
Stage of perinatal development regulates skeletal
muscle mitochondrial biogenesis and myogenic
regulatory factor genes with little impact of growth
restriction or cross-fostering
R. C. Laker
1
, G. D. Wadley
1,2
, G. K. McConell
1,3
and M. E. Wlodek
1
*
1
Department of Physiology, The University of Melbourne, Parkville, Victoria, Australia
2
Centre for Physical Activity and Nutrition Research, School of Exercise and Nutrition Sciences, Deakin University, Burwood,
Victoria, Australia
3
Institute of Sport, Exercise and Active Living and the School of Biomedical and Health Sciences, Victoria University, Victoria, Australia
Foetal growth restriction impairs skeletal muscle development and adult muscle mitochondrial biogenesis. We hypothesized that key genes
involved in muscle development and mitochondrial biogenesis would be altered following uteroplacental insufficiency in rat pups, and
improving postnatal nutrition by cross-fostering would ameliorate these deficits. Bilateral uterine vessel ligation (Restricted) or sham (Control)
surgery was performed on day 18 of gestation. Males and females were investigated at day 20 of gestation (E20), 1 (PN1), 7 (PN7) and 35
(PN35) days postnatally. A separate cohort of Control and Restricted pups were cross-fostered onto a different Control or Restricted mother and
examined at PN7. In both sexes, peroxisome proliferator-activated receptor (PPAR)-g coactivator-1a (PGC-1a), cytochrome c oxidase
subunits 3 and 4 (COX III and IV) and myogenic regulatory factor 4 expression increased from late gestation to postnatal life, whereas
mitochondrial transcription factor A, myogenic differentiation 1 (MyoD), myogenin and insulin-like growth factor I (IGF-I) decreased. Foetal
growth restriction increased MyoD mRNA in females at PN7, whereas in males IGF-I mRNA was higher at E20 and PN1. Cross-fostering
Restricted pups onto a Control mother significantly increased COX III mRNA in males and COX IV mRNA in both sexes above controls with
little effect on other genes. Developmental age appears to be a major factor regulating skeletal muscle mitochondrial and developmental genes,
with growth restriction and cross-fostering having only subtle effects. It therefore appears that reductions in adult mitochondrial biogenesis
markers likely develop after weaning.
Received 20 March 2011; Revised 25 August 2011; Accepted 30 September 2011; First published online 10 November 2011
Key words: gene expression, growth, growth restriction, skeletal muscle
Introduction
Being born small for gestational age significantly increases the
risk of developing insulin resistance and type 2 diabetes later in
life.
1–4
Skeletal muscle insulin resistance has been associated with
impaired skeletal muscle mitochondrial biogenesis (synthesis of
new mitochondria) and metabolism.
5–7
Mitochondria are the
primary controllers of cellular energy metabolism and impair-
ments in skeletal muscle mitochondrial content and function
havebeenshowninadultratsbornsmall.
8,9
Our laboratory has
shown that foetal growth restriction reduces gene and protein
markers of skeletal muscle mitochondrial biogenesis [e.g. per-
oxisome proliferator-activ ated receptor (PPAR)-g coactivator-1a
(PGC-1a), mitochondrial transcription factor A (Tfam), cyto-
chrome c oxidase subunits 3 and 4 (COX III and IV)] in
6-month-old adult rats, with males more affected than females.
8
This potential impairment in skeletal muscle metabolism may
provide an important mechanistic link to skeletal muscle insul in
resistance
5–7
associated with being born small.
The developmental time course for the reduction in mar-
kers of skeletal muscle mitochondrial biogenesis following
uteroplacental insufficiency is unclear. One study reported
that the master regulator of mitochondrial biogenesis, PGC-
1a, mRNA was downregulated in the slow twitch soleus
muscle but upregulated in the fast twitch extensor digitorum
longus muscle of small birth weight offspring at 21 days of
age, with males more affected than females.
10
It is important
to consider that the control group used in these studies had
their litter size reduced at birth,
10,11
previously shown to alter
postnatal growth and impair skeletal muscle markers of
mitochondrial biogenesis at 6 months of age
8
and therefore
impacts on the interpretation of these findings. Conse-
quently, the impact of foetal growth restriction on markers of
skeletal muscle mitochon drial biogenesis and the develop-
mental time course in early life remains unclear.
Low birth weight in humans has also been associated with
reduced muscle mass and strength that persists from child-
hood
12–15
through to adult life.
16–18
Evidence suggests that
*Author for correspondence: Prof M. E. Wlodek, Department of
Physiology, The University of Melbourne, Parkville, Victoria 3010, Australia.
(Email m.wlodek@unimelb.edu.au)

the struct ural and functional development of muscles and
muscle fibres is altered in babies born small
18–23
and this is
likely to play an important role in the programming of adult
disease. Animal studies show that foetal undernutrition is asso-
ciated with reduced postnatal muscle weight and myofibre
density,
20,21,24
along with impaired morphological and con-
tractile characteristics
22,23
that may persist into adulthood.
25
In
the rat, skeletal muscle develops during mid-to-late gestation and
continues to grow some months postnatally.
26–28
During gesta-
tion, skeletal muscle development coincides with the expres sion
of myogenic regulatory factors (MRFs), which are temporally
expressed throughout perinatal development and control an array
of regulatory and structural genes.
29–32
Myogenic differentiation
1 (MyoD), myogenin and MRF4 are involved in skeletal muscle
proliferation and differentiation with expression detected from
mid-to-late gestation.
27,33–35
In the r at, myogenesis continues for
up to 2 weeks postnatally after which skeletal muscle hyper-
trophy persists. Insulin-like growth factor I (IGF-I) plays a well-
defined role in skeletal muscle hypertrophy,
36–38
but evidence
also implicates IGF-I in skeletal muscle proliferation and dif-
ferentiation.
39
Owing to the temporal pattern of MRF expres-
sion, the timing of an insult may be an important determinant of
the muscle’s phenotypic profile. An insult, during gestation or
after birth, may alter the expression of these myogenic regulatory
andgrowthfactorsandmayimpactonlaterskeletalmusclemass
and function.
Our laboratory has shown that uteroplacental insufficiency
in pregnant rats not only impairs the growth of the foetus but
also impairs maternal mammary development resulting in
poor lactation,
40
further compromising the growth of the
offspring after birth.
41
In low birth weight humans, improved
growth between birth and 2 y ears has been shown to reduce the
risk of developing adult metabolic disease.
4,42–44
Indeed, Siebel
et al. have shown that improved postnatal nutrition by cross-
fostering growth-restricted pups onto a control mother with
normal lactation, improved early postnatal growth and amelio-
rated the impaired glucose tolerance
45
and pancreatic b-cell
mass
46
observed at 6 months of age. Furthermore, at 7 days of
age, restricted pups fostered onto a control mother showed
upregulation of key pancreatic genes important for b-cell growth
and maintenance.
46
These results highlight the potential for early
life interventions that may lessen the adverse consequences of
being born small.
Therefore, Study 1 determined the impact of uteroplacenta l
insufficiency on gene expression of skeletal muscle markers of
mitochondrial biogenesis and myogenic regulatory and growth
factors in late gestation and during postnatal life. Study 2
determined whether improved lactation after birth by cross-
fostering could ameliorate any adverse consequences of uter-
oplacental insufficiency on skeletal muscle gene expression in
early life. Finally, due to multiple and significant gender differ-
ences in metabolic disease outcomes in response to impaired
foetal growth reported previously by ourselves
8,45
and others,
47–49
we determined the impact of uteroplacental insufficiency and
cross-fostering in males and females separately. On the basis of
our and others findings in adulthood, we hypothesized that key
genes involved in skeletal muscle development and mitochondrial
biogenesis would be altered following intrauterine growth
restriction in rats, with different developmental profiles between
males and females.
Methods
Animals
All procedures were approved by The University of Melbourne
Animal Experimentation Sub-Committee. In both studies,
Wistar Kyoto rats (aged 11 weeks) were obtained from the
Australian Resource Centre (Murdoch, WA, Australia) and
house with a 12-h light dark cycle with access to water and
normal chow ad libitum. On day 18 of gestation (term 22 days),
pregnant rats were anesthetized by intraperitoneal injection
of ketamine (225 mg/kg) and Ilium Xylazil-20 (30 mg/kg).
Bilateral uterine vessel ligation of both the artery and vein
supplying each uterine horn was performed to induce late
gestation uteroplacental insuf ficiency (Restricted) or sham
surgery was performed to generate the Control group.
50,51
Study 1: developmental timeline study
At day 20 of gestation (E20), mothers that underwent either
bilateral uterine vessel ligation or sham surgery were anes-
thetized by intraperitoneal injection of ketamine (225 mg/kg)
and Ilium Xylazil-20 (30 mg/kg) and the uterus exposed. In
Restricted litters at E20, the ligation integrity was confirmed.
Foetuses at E20 or pups at postnatal day 1 (PN1) and 7 (PN7)
were weighed, killed by decapitation and hindlimb skeletal
muscle rapidly excised, pooled within litters and separated by sex
(n 5 8–10 litters/group). Skeletal muscle was not weighed at
ages E20, PN1 or PN7 due to potential inaccuracies in dissec-
tion of the muscle in the small animals. Because of the increased
body mass at postnatal day 35 (PN35) individual male and
female offspring were anesthetized by intraperitoneal injection of
ketamine (225 mg/kg) and Ilium Xylazil-20 (30 mg/kg) and the
gastrocnemius muscle rapidly excised and weighed (n 5 8–10
offspring/group). The gastrocnemius muscle was examined at
PN35 as it is the largest muscle of the lower hindlimb and is also
a mixed fibre muscle making it an appropriate hindlimb muscle
for comparing to mixed hindlimb muscle collected at earlier
ages. All samples collected were immediately frozen in liquid
nitrogenandstoredat2808C.
Study 2: cross-fostering study
In a separate cohort of offspring exposed to uteroplacental
insufficiency or sham surgery, Restricted or Control pups were
cross-fostered 1 day after birth onto either a mother who had
undergone bilateral uterine vessel ligation or a sham-operated
Control mother to yield four treatment groups. Control pups
fostered onto a Control mother (Cont-on-Cont ), Control pups
40 R. C. Laker et al.

on Restricted mother (Cont-on-Rest), Restricted pups on Control
mother (Rest-on-Cont)andRestricted pups on Restricted mother
(Rest -on-Res t).
46
To determine the early effects of foetal growth
restriction and cross-fostering before the majority of proliferation
and differentiation was complete, hindlimb skeletal muscle was
collected at PN7 as described above (n 5 7–10 litters/group).
Analysis for studies 1 and 2: real-time poly merase
chain reaction (PCR) analysis
For the Developmental Timeline Study, total RNA was extracted
from skeletal muscle using the Tri-Reagent (Ambion Inc.,
Austin,TX,USA)methodduetothesmallamountsofpooled
tissue obtained from pups at E20 and PN1. RNA was extracted
from skeletal muscle of the Cross-foster Study using the Invitro-
gen micro–to-midi RNA extraction kits (Invitrogen, Carlsbad,
CA, USA). RNA yield was measured using the NanoDrop
TM
1000 Spectrophotometer (NanoDrop Technologies, Wilming-
ton, DE, USA) at 260 nm absorbance. Integrity was confirmed
from the 260/280 nm ratio and random samples were also
selected for gel electrophoresis with high levels of 18S and 28S
detected.
First-strand cDNA was synthesized from 1 mg of RNA
using superscript III first-strand system (Invitrogen). Primer
and Taqman
R
probe sequences for PGC-1a, Tfam, COX
III, COX IV, myogenin, MyoD, MRF4, IGF-I, b-actin and
18S are presented in Table 1. Depending on probe availability,
real-time PCR using either SYBR green
8
or TaqMan
R
52
chemistry was performed, as described previously, using the
sequence detector software (Rotor-gene v6, Corbett Research,
Sydney, NSW, Australia). Samples from each age within an
experimental group were amplified on the same run to eliminate
inter-assay variability, whereas a positive control sample was used
as a reference to make inter-assay comparisons within an age
group. In cases when SYBR green chemistry (Tfam, COX III
and COX IV) was utilized, samples were subjected to a heat
dissociation protocol following the final amplification cycle to
ensure that only a single product was detected. Relative gene
expression was quantified using the comparative C
t
(DDC
t
)
method.
8,46
18S was used as the endogenous control for the
Developmental Timeline Study (Study 1) as it was stably
expressed across age groups, whereas b-actin was used for the
Cross-foster Study (Study 2) due to stable expression between
treatment groups at that age.
Studies 1 and 2: statistical analysis
At each age, body weight and dimensions were analysed by a
two-way ANOVA for sex and treatment. For the Develop-
mental Timeline Study, gene expression data were analysed
separately for sex using a two-way ANOVA for age and
treatment. If a statistically significant interaction was
observed, data were then split and analysed by one-way
ANOVA with Du ncan’s post hoc test where appropriate. For
the Cross-foster Study, gene expression data were analysed
Table 1. Primer and probe sequences used for genes quantified using real-time PCR relative to 18S or b-actin and GenBank accession numbers
Gene Forward 5
0
–3
0
Reverse 5
0
–3
0
Probe 5
0
–3
0
GenBank accession
PGC-1a CGTAGGCCCAGGTATGACA GCGGTATTCGTCCCTCTTCA ATGAAGCCAATGAGCACGAAAGGC NM_031347
Tfam AGCCATGTGGAGGGAGCTT TTGTACACCTTCCACTCAGCTTTAA N/A NM_031326
COX III GACGGAATTTACGGCTCAACAT AATTAGGAAAGTTGAGCCAATAATTACG N/A AF504920
COX IV GTGCTGATCTGGGAGAAGAGCTA GGTTGACCTTCATGTCCAGCAT N/A NM_017202
Myogenin GAAGCGCAGGCTCAAGAAAG GCGCAGGATCTCCACCTTAG TGAATGAGGCCTTCGAGGCTCTG NM_017115
MyoD CAGCGGCTACCCAAGGTG AGAGCCTGCAGACCTTCAATGTAG AGATCCTGCGCAACGCCATCCG NM_176079
MRF4 TGAGGGTGCGGATTTCCT GCTTGCTCCTCCTTCCTTAGC CAGCCCGCAGTGGCCAAGTG M27151
IGF-I CCAGCGCCACACTGACATG GGGAGGCTCCTCCTACATTC CCCAAGACTCAGAAGGAAGTACACTTGA X_06043
b-Actin ACCCAGATCATGTTTGAGACCTTCA AGAGGCATACAGGGACAACACA CCCAGCCATGTACGTAGCCATCC NM_031144
18S GCATGGCCGTTCTTAGTTGG TGCCAGAGTCTCGTTCGTTA TGGAGCGATTTGTCTGGTTAATTCCGA V01270.1
PGC-1a, peroxisome proliferator-activated receptor (PPAR)-g coactivator-1a; Tfam, mitochondrial transcription factor A; COX III and IV, cytochrome c oxidase subunits 3 and 4;
MyoD, myogenic differentiation 1; MRF4, myogenic regulatory factor 4; IGF-1, insulin-like growth factor 1.
Growth restriction and muscle development 41

separately for sex using a one-way ANOVA for treatment.
All data are presented as the mean 6
S.E.M. The level of
significance was set at P , 0.05.
Results
Study 1: developmental timeline study
Body weight, dimensions and litter size
Litter size was reduced by uteroplacental insufficiency during
gestation at E20 (8.1 6 0.7 v. 10.5 6 0.9; P 5 0.05) and after
birth at PN1 (5.2 6 0.6 v. 8.2 6 0.5; P , 0.05). Restricted
offspring were lighter (P , 0.05) with shorter crown-rump
length (P , 0.05) than Control at all ages in males and at E20,
PN1andPN7infemales(Table2).Hindlimblengthwas
shorter in Restricted malesatE20andinbothsexesatPN7
(Table2).HeadlengthwasshorterinRestricted at PN1 and
head width was shorted in Restricted at PN7 compared with
Controls in both sexes (Table 2). Foetal growth restriction
reduced PN35 absolute gastrocnemius weight in males
(0.26 6 0.01 g v. 0.20 6 0.01 g; P , 0.05), but not in females
(0.20 6 0.02 g v. 0.21 6 0.02 g). Relative (to body weight)
gastrocnemius weight was unaffected by foetal growth restric-
tion in both males (0.34 6 0.02 g v. 0.32 6 0.01 g) and females
(0.31 6 0.02 g v. 0.32 6 0.03 g).
Skeletal muscle gene expression
Skeletal muscle mitochondrial biogenesis markers
Uteroplacental insufficiency had no impact on skeletal muscle
gene expression of mitochondrial biogenesis markers regard-
less of sex (Fig. 1). In both males and females, PGC-1a
mRNA was lowest at E20 (P , 0.05) and showed increasing
(P , 0.05) expression such that by PN35 was more than
four-fold higher (P , 0.05) than E20 (Fig. 1a and 1e). In
females, Tfam mRNA was similar between E20 and PN1 and
peaked (P ,
0.05) at PN7 (Fig. 1f). In males, Tfam mRNA
was similar at E20, PN1 and PN7 and decreased (P , 0.05)
only at PN35 (Fig. 1b). COX III mRNA levels were similar at
E20, PN1 and PN7 and increased (P , 0.05) substantially by
PN35 in both males and females (Fig. 1c and 1g). Finally,
COX IV mRNA in males and females was similar at E20 and
PN1 and progressively increased such that it was highest
(P , 0.05) at PN35 (Fig. 1d and 1h).
Myogenic regulatory and growth factors
In both males and females, MyoD and myogenin mRNA pro-
gressively decreased such that it was highest at E20 (P , 0.05)
and lowest (P , 0.05) at PN35 (Fig. 2a, 2b, 2e and 2f, respec-
tively). Uteroplacental insufficiency had no impact on MyoD
and myogenin mRNA in either sex (Fig. 2a, 2e, 2b and 2f,
respectively) except in females at PN7, MyoD mRNA was
, 40% higher (Fig. 2e; P , 0.05). MRF4 mRNA was lowest
(P, 0.05) at E20 and progressively increased (P , 0.05) to
Table 2. Effect of uteroplacental insufficiency on body weight and dimensions in males and females at E20, PN1, PN7 and PN35
E20 PN1 PN7 PN35
Cont Rest Cont Rest Cont Rest Cont Rest
Males
Body weight (g) 1.82 6 0.06 1.53 6 0.15* 4.28 6 0.09 3.44 6 0.14* 10.33 6 0.27 6.95 6 0.50* 76.05 6 3.04 62.72 6 3.66*
Crown rump (mm) 27.13 6 0.43 25.11 6 2.22* 35.29 6 0.41 32.51 6 0.54* 48.92 6 0.77 42.41 6 0.68* 103.78 6 1.66 95.03 6 1.98*
Hindlimb length (mm) 6.40 6 0.11 5.96 6 0.54* 9.45 6 0.08 9.37 6 0.25 14.66 6 0.28 12.54 6 0.46* 34.44 6 0.71 32.52 6 0.46
Head length (mm) 9.78 6 0.11 10.79 6 1.67 12.99 6 0.25 11.78 6 0.35* 17.61 6 0.36 16.95 6 0.51 32.99 6 0.40 31.81 6 0.50
Head width (mm) 6.54 6 0.08 6.55 6 0.68 8.89 6 0.13 8.59 6 0.14 12.28 6 0.09 11.11 6 0.29* 19.58 6 0.19 18.53 6 0.46
Females
Body weight (g) 1.71 6 0.03 1.48 6 0.05* 4.04 6 0.06 3.53 6 0.16* 9.41 6 0.22 6.84 6
0.40* 65.91 6 2.73 64.06 6 3.42
Crown rump (mm) 26.40 6 0.34 25.13 6 0.58 34.84 6 0.21 31.97 6 0.62* 47.55 6 0.79 41.73 6 1.01* 97.89 6 2.19 98.62 6 3.0
Hind limb length (mm) 6.38 6 0.07 6.02 6 0.15 9.50 6 0.11 9.40 6 0.13 14.23 6 0.22 12.78 6 0.29* 32.99 6 0.51 32.60 6 1.07
Head length (mm) 9.60 6 0.09 10.72 6 1.35 13.13 6 0.17 11.98 6 0.28* 17.57 6 0.37 17.02 6 0.33 32.19 6 0.48 31.75 6 0.33
Head width (mm) 6.49 6 0.12 6.48 6 0.33 9.00 6 0.14 8.74 6 0.21 12.03 6 0.11 11.11 6 0.17* 18.89 6 0.24 19.52 6 0.27
E20, day 20 of gestation; PN1, postnatal day 1; PN7; postnatal day 7; PN35, postnatal day 35; Cont, Control; Rest, Restricted.
*Denotes significantly (P , 0.05) different from Cont within that age.
Body weight, crown-rump length, hindlimb length, head length and head width measured for male and female offspring. Data are expressed as mean 6
S.E.M.(n 5 8–10/group).
42 R. C. Laker et al.

Figures
Citations
More filters
Journal ArticleDOI

Developmental and Transmittable Origins of Obesity-Associated Health Disorders

TL;DR: In this review, several studies are highlighted that have revealed the role of epigenetics in multigenerational transmission of developmentally programmed obesity and associated cardiometabolic disease.
Journal ArticleDOI

Reversal of Defective Mitochondrial Biogenesis in Limb-Girdle Muscular Dystrophy 2D by Independent Modulation of Histone and PGC-1α Acetylation

TL;DR: It is demonstrated that mitochondrial biogenesis was impaired in limb-girdle muscular dystrophy (LGMD) 2D patients and mice and was associated with impaired OxPhos capacity and could be recovered by TSA changing chromatin conformation, or it could be overcome by NO activating a mitochondrial salvage pathway.
Journal ArticleDOI

Changes in muscle fiber type and expression of mRNA of myosin heavy chain isoforms in porcine muscle during pre- and postnatal development.

TL;DR: It seems that a certain plasticity of muscle fiber type still remains in this developmental stage of the pig, as shown by the rapid and considerable changes in expression of MHC 2b mRNA.
Journal ArticleDOI

Gestational exposure to excessive levels of dexamethasone impairs maternal care and impacts on the offspring's survival in rats.

TL;DR: Exposure to DEX during late gestation causes behavioral changes that compromise the maternal emotional state, disrupting the expression of MC, and data indicate that an adequate MC improves pup's survival in this model.
References
More filters
Journal ArticleDOI

Effects of uteroplacental restriction on the relaxin-family receptors, Lgr7 and Lgr8, in the uterus of late pregnant rats

TL;DR: Data suggest that both relaxin family receptors are upregulated in response to a reduction in uteroplacental blood flow in rats.
Journal ArticleDOI

The origin and selective innervation of early muscle fiber types in the rat.

TL;DR: Evidence obtained from experiments identifying the types of fibers innervated by single motors suggests that the nervous system comes to recognize this diversity of muscle fiber types, at least during early postnatal life.
Journal ArticleDOI

Efeito da desnutrição protéica pré e pós-natal sobre a morfologia, a diferenciação e o metabolismo do tecido muscular estriado esquelético em ratos

TL;DR: Os resultados experimentais sugerem that, alem da reducao no numero of fibras, a desnutricao promove um retardamento na diferenciacao das caracteristicas morfologicas, metabolicas e contrateis dos tipos de fibrAs musculares esqueleticas em ratos na fase of crescimento.
Related Papers (5)
Frequently Asked Questions (15)
Q1. What contributions have the authors mentioned in the paper "Stage of perinatal development regulates skeletal muscle mitochondrial biogenesis and myogenic regulatory factor genes with little impact of growth restriction or cross-fostering" ?

Wlodek et al. this paper showed that foetal growth restriction reduces gene and protein markers of skeletal muscle mitochondrial biogenesis. 

skeletal muscle differentiation in the human does continue after birth with up to 20% of fibres undifferentiated in the newborn, which drops to adult levels by 1 year of age. 

Their laboratory has shown that foetal growth restriction reduces gene and protein markers of skeletal muscle mitochondrial biogenesis [e.g. peroxisome proliferator-activated receptor (PPAR)-g coactivator-1a (PGC-1a), mitochondrial transcription factor A (Tfam), cytochrome c oxidase subunits 3 and 4 (COX III and IV)] in 6-month-old adult rats, with males more affected than females. 

Their laboratory has shown that uteroplacental insufficiency in pregnant rats not only impairs the growth of the foetus but also impairs maternal mammary development resulting in poor lactation,40 further compromising the growth of the offspring after birth. 

One study reported that the master regulator of mitochondrial biogenesis, PGC1a, mRNA was downregulated in the slow twitch soleus muscle but upregulated in the fast twitch extensor digitorum longus muscle of small birth weight offspring at 21 days of age, with males more affected than females. 

Cross-fostering Restricted pups onto a Control mother significantly increased COX III mRNA in males and COX IV mRNA in both sexes above controls with little effect on other genes. 

Developmental age appears to be a major factor regulating skeletal muscle mitochondrial and developmental genes, with growth restriction and cross-fostering having only subtle effects. 

Analysis for studies 1 and 2: real-time polymerase chain reaction (PCR) analysisFor the Developmental Timeline Study, total RNA was extracted from skeletal muscle using the Tri-Reagent (Ambion Inc., Austin, TX, USA) method due to the small amounts of pooled tissue obtained from pups at E20 and PN1. 

How this will impact on the adult skeletal muscle metabolic profile is unknown, but as cross-fostering has been associated with improved glucose tolerance in adulthood of small birth weight rats,45 the gene changes in skeletal muscle may also contribute to improved adult health. 

Whether these relatively minor gene changes following cross-fostering will contribute to later disease prevention, observed at 6 months of age,45,46,51 is unclear; but perhaps an intervention that occurs at an age when deficits in skeletal muscle mitochondrial biogenesis markers are present would provide greater benefits to improved skeletal muscle mitochondrial biogenesis and insulin sensitivity. 

more recently Costello et al.24 reported that following late gestation undernutrition in sheep, reduced myofibre density was associated with a compensatory upregulation of the IGF-I receptor at127 days gestation (term 147 days). 

In low birth weight humans, improved growth between birth and 2 years has been shown to reduce the risk of developing adult metabolic disease. 

On the basis ofour and others findings in adulthood, the authors hypothesized that key genes involved in skeletal muscle development and mitochondrial biogenesis would be altered following intrauterine growth restriction in rats, with different developmental profiles between males and females. 

It is important to consider that the control group used in these studies had their litter size reduced at birth,10,11 previously shown to alter postnatal growth and impair skeletal muscle markers of mitochondrial biogenesis at 6 months of age8 and therefore impacts on the interpretation of these findings. 

It was particularly surprising to find that foetal growth restriction had no impact on PGC-1a gene expression as uteroplacental insufficiency causes foetal hypoxia and in skeletal muscle the hypoxia inducible factor 1 activity and expression is tightly coupled to PGC-1a.60