Showing papers on "Circular dichroism published in 2005"
TL;DR: The basis of the CD approach and its application to the study of proteins, and clear guidelines on how reliable data can be obtained and analysed are presented.
3,023 citations
TL;DR: The DNA sequence, d(AGGGAGGGCGCTGGGAGG AGGAGGG), occurs within the promoter region of the c-kit oncogene and it is shown that this sequence forms a four-stranded quadruplex structure under physiological conditions.
Abstract: The DNA sequence, d(AGGGAGGGCGCTGGGAGGAGGG), occurs within the promoter region of the c-kit oncogene. We show here, using a combination of NMR, circular dichroism, and melting temperature measurements, that this sequence forms a four-stranded quadruplex structure under physiological conditions. Variations in the sequences that intervene between the guanine tracts have been examined, and surprisingly, none of these modified sequences forms a quadruplex arrangement under these conditions. This suggests that the occurrence of quadruplex-forming sequences within the human and other genomes is less than was hitherto expected. The c-kit quadruplex may be a new target for therapeutic intervention in cancers where there is elevated expression of the c-kit gene.
511 citations
TL;DR: The abnormal aggregation of the microtubule associated protein tau into paired helical filaments (PHFs) is one the hallmarks of Alzheimer's disease and PHFs aggregated in vitro and in vivo contain beta-sheet structure, as judged by circular dichroismSpectroscopy, Fourier transform infrared (FTIR) spectroscopy and X-ray diffraction.
348 citations
TL;DR: It is shown that a central sequence of about 40 amino acids in ArfGAP1 acts as a lipid‐packing sensor, and site‐directed mutagenesis, limited proteolysis and circular dichroism experiments suggest that the ALPS motif, which is unstructured in solution, inserts bulky hydrophobic residues between loosely packed lipids and forms an amphipathic helix on highly curved membranes.
Abstract: ArfGAP1 promotes GTP hydrolysis in Arf1, a small G protein that interacts with lipid membranes and drives the assembly of the COPI coat in a GTP-dependent manner. The activity of ArfGAP1 increases with membrane curvature, suggesting a negative feedback loop in which COPI-induced membrane deformation determines the timing and location of GTP hydrolysis within a coated bud. Here we show that a central sequence of about 40 amino acids in ArfGAP1 acts as a lipid-packing sensor. This ALPS motif (ArfGAP1 Lipid Packing Sensor) is also found in the yeast homologue Gcs1p and is necessary for coupling ArfGAP1 activity with membrane curvature. The ALPS motif binds avidly to small liposomes and shows the same hypersensitivity on liposome radius as full-length ArfGAP1. Site-directed mutagenesis, limited proteolysis and circular dichroism experiments suggest that the ALPS motif, which is unstructured in solution, inserts bulky hydrophobic residues between loosely packed lipids and forms an amphipathic helix on highly curved membranes. This helix differs from classical amphipathic helices by the abundance of serine and threonine residues on its polar face.
347 citations
TL;DR: The results of spectroscopic measurements and the thermodynamic parameters obtained suggest that hydrophobic interaction is the predominant intermolecular forces stabilizing the complex, which is also good agreement with the results of molecule modeling study.
346 citations
TL;DR: The results of biophysical experiments in solution and computational studies that are inconsistent with the reported crystal structure suggest that the biologically relevant structure of the human telomere quadruplex in K+ solution is not the one determined in the published crystalline state.
Abstract: The structure of human telomere DNA is of intense interest because of its role in the biology of both cancer and aging. The sequence [5 0 -AGGG(TTAGGG)3] has been used as a model for telomere DNA in both NMR and X-ray crystallographic studies, the results of which show dramatically different structures. In Na 1 solution, NMR revealed an antiparallel G-quadruplex structure that featured both diagonal and lateral TTA loops. Crystallographic studies in the presence of K 1 revealed a flattened, propeller-shaped structure featuring a parallel-stranded G-quadruplex with symmetrical external TTA loops. We report the results of biophysical experiments in solution and computational studies that are inconsistent with the reported crystal structure, indicating that a different structure exists in K 1 solutions. Sedimentation coefficients were determined experimentally in both Na 1 and K 1 solutions and were compared with values calculated using bead models for the reported NMR and crystal structures. Although the solution NMR structure accurately predicted the observed S-value in Na 1 solution, the crystal structure predicted an S-value that differed dramatically from that experimentally observed in K 1 solution. The environments of loop adenines were probed by quantitative fluorescence studies using strategic and systematic singlesubstitutions of 2-aminopurine for adenine bases. Both fluorescence intensity and quenching experiments in K 1 yielded results at odds with quantitative predictions from the reported crystal structure. Circular dichroism and fluorescence quenching studies in the presence of the crowding agent polyethylene glycol showed dramatic changes in the quadruplex structure in K 1 solutions, but not in Na 1 solutions, suggesting that the crystal environment may have selected for a particular conformational form. Molecular dynamics simulations were performed to yield model structures for the K 1 quadruplex form that are consistent with our biophysical results and with previously reported chemical modification studies. These models suggest that the biologically relevant structure of the human telomere quadruplex in K 1 solution is not the one determined in the published crystalline state.
328 citations
TL;DR: From atomic force microscopy, it is found that most of the fibrils from hen egg white lysozyme have a thickness of approximately 4 nm and have a coiled structure with a periodicity of approximately 30 nm and show characteristic defects after every four or five turns.
327 citations
TL;DR: The biochemical and biological consequences of binding of ligands to G-quadruplex structures found in telomeres and promoter regions of certain important oncogenes go beyond mere stabilization of these structures.
Abstract: The human telomeric sequence d[T(2)AG(3)](4) has been demonstrated to form different types of G-quadruplex structures, depending upon the incubation conditions. For example, in sodium (Na(+)), a basket-type G-quadruplex structure is formed. In this investigation, using circular dichroism (CD), biosensor-surface plasmon resonance (SPR), and a polymerase stop assay, we have examined how the addition of different G-quadruplex-binding ligands affects the conformation of the telomeric G-quadruplex found in solution. The results show that while telomestatin binds preferentially to the basket-type G-quadruplex structure with a 2:1 stoichiometry, 5,10,15,20-[tetra-(N-methyl-3-pyridyl)]-26-28-diselena sapphyrin chloride (Se2SAP) binds to a different form with a 1:1 stoichiometry in potassium (K(+)). CD studies suggest that Se2SAP binds to a hybrid G-quadruplex that has strong parallel and antiparallel characteristics, suggestive of a structure containing both propeller and lateral, or edgewise, loops. Telomestatin is unique in that it can induce the formation of the basket-type G-quadruplex from a random coil human telomeric oligonucleotide, even in the absence of added monovalent cations such as K(+) or Na(+). In contrast, in the presence of K(+), Se2SAP was found to convert the preformed basket G-quadruplex to the hybrid structure. The significance of these results is that the presence of different ligands can determine the type of telomeric G-quadruplex structures formed in solution. Thus, the biochemical and biological consequences of binding of ligands to G-quadruplex structures found in telomeres and promoter regions of certain important oncogenes go beyond mere stabilization of these structures.
323 citations
TL;DR: This class of reverse PAs has made it possible to create biologically significant assemblies with free N-terminal peptide sequences, which were previously inaccessible, including those derived from phage display methodologies.
Abstract: The design, synthesis, and characterization of "reverse" peptide amphiphiles (PAs) with free N-termini is described Use of an unnatural amino acid modified with a fatty acid tail allows for the synthesis of this new class of PA molecules The mixing of these molecules with complementary ones containing a free C-terminus results in coassembled structures, as demonstrated by circular dichroism and NOE/NMR spectroscopy These assemblies show unusual thermal stability when compared to assemblies composed of only one type of PA molecule This class of reverse PAs has made it possible to create biologically significant assemblies with free N-terminal peptide sequences, which were previously inaccessible, including those derived from phage display methodologies
296 citations
TL;DR: A diagram is presented illustrating the DNA-binding mechanism of the antimicrobial action of indolicidin and explaining the roles of the peptide when interacting with lipid bilayers at different concentrations, based on biophysical studies and previous results.
Abstract: Indolicidin, a l3-residue antimicrobial peptide-amide, which is unusually rich in tryptophan and proline, is isolated from the cytoplasmic granules of bovine neutrophils. In this study, the structures of indolicidin in 50% D3-trifluoroethanol and in the absence and presence of SDS and D38-dodecylphosphocholine were determined using NMR spectroscopy. Multiple conformations were found and were shown to be due to different combinations of contact between the two WPW motifs. Although indolicidin is bactericidal and able to permeabilize bacterial membranes, it does not lead to cell wall lysis, showing that there is more than one mechanism of antimicrobial action. The structure of indolicidin in aqueous solution was a globular and amphipathic conformation, differing from the wedge shape adopted in lipid micelles, and these two structures were predicted to have different functions. Indolicidin, which is known to inhibit DNA synthesis and induce filamentation of bacteria, was shown to bind DNA in gel retardation and fluorescence quenching experiments. Further investigations using surface plasmon resonance confirmed the DNA-binding ability and showed the sequence preference of indolicidin. Based on our biophysical studies and previous results, we present a diagram illustrating the DNA-binding mechanism of the antimicrobial action of indolicidin and explaining the roles of the peptide when interacting with lipid bilayers at different concentrations.
276 citations
TL;DR: The structures of the proteins as determined by circular dichroism indicate changes in the tertiary structure with the secondary structure remaining intact.
Abstract: In the context of this study, the noncovalent binding of selected phenolic compounds (chlorogenic, ferulic, and gallic acids, quercetin, rutin, and isoquercetin) to different proteins (human serum albumin, bovine serum albumin, soy glycinin, and lysozyme) was studied with direct (Hummel-Dreyer/size exclusion chromatography) and/or indirect methods (fluorescence absorbance properties of the binding components) In the latter case, the measurement of the phenol binding was achieved by exploiting the intrinsic fluorescence emission properties of quercetin as a probe From the data obtained, the binding constants and the number of binding sites were calculated The binding parameters were influenced by different factors, where, eg, increasing temperature and ionic strength as well as decreasing pH cause a diminished binding The structures of the proteins as determined by circular dichroism indicate changes in the tertiary structure with the secondary structure remaining intact
TL;DR: Data from circular dichroism and fluorescence spectroscopy indicate that conditions that promote weakly stable alpha-helical conformations may promote IAPP aggregation and the potential roles of IAPP-membrane interaction and the novel membrane-bound alpha- helical conformation in IAP aggregation are discussed.
Abstract: The 37-residue islet amyloid polypeptide (IAPP) is thought to play an important role in the pathogenesis of type II diabetes. Despite a growing body of evidence implicating membrane interaction in IAPP toxicity, the membrane-bound form has not yet been well characterized. Here we used circular dichroism (CD) and fluorescence spectroscopy to investigate the molecular details of the interaction of IAPP with lipid membranes of varying composition. In the presence of membranes containing negatively charged phosphatidylserine (PS), we observed significant acceleration in the formation of IAPP aggregates. This acceleration is strongly modulated by the PS concentration and ionic strength, and is also observed at physiologically relevant PS concentrations. CD spectra of IAPP obtained immediately after the addition of membranes containing PS revealed features characteristic of an alpha-helical conformation approximately approximately 15-19 residues in length. After a longer incubation with membranes, IAPP gave rise to CD spectra characteristic of a beta-sheet conformation. Taken together, our CD and fluorescence data indicate that conditions that promote weakly stable alpha-helical conformations may promote IAPP aggregation. The potential roles of IAPP-membrane interaction and the novel membrane-bound alpha-helical conformation in IAPP aggregation are discussed.
TL;DR: Circular dichroism (CD) spectroscopy confirmed the mirror image relationship between the D-Pen-capped and the L- penicillamine gold nanoclusters, suggesting that the surface modifier acts as a chiral selector, and that the nanocluster have well-defined stereostructures as common chiral molecules do.
Abstract: We have succeeded for the first time in preparing a pair of gold nanocluster enantiomers protected by optically active thiols: D- and L-penicillamine (D-Pen and L-Pen). Circular dichroism (CD) spectroscopy confirmed the mirror image relationship between the D-Pen-capped and the L-Pen-capped gold nanoclusters, suggesting that the surface modifier acts as a chiral selector, and that the nanoclusters have well-defined stereostructures as common chiral molecules do. No CD signals could be obtained when the gold nanoclusters were synthesized by using a racemic mixture (rac-Pen). These chiroptical properties were investigated for the three separated fractions of each of the gold nanoclusters (D-Pen-capped, L-Pen-capped, or rac-Pen-capped clusters) by polyacrylamide gel electrophoresis (PAGE). Each fractioned component has the mean diameter of 0.57, 1.18, or 1.75 nm that was determined by a solution-phase small-angle X-ray scattering. With a decrease in the mean cluster diameter, optical activity or anisotropy factors gradually increased. On the basis of the kinetic and the structural considerations, the origins of large optical activity of the gold nanocluster enantiomers are discussed.
TL;DR: Measurements of colloidal properties (size and zeta potential) as a function of charge ratio reveal that highly transfecting dendrimer/DNA complexes have size/zeta potential values between 4 and 8, which may be due to the heterogeneity of the complexes.
TL;DR: Water-soluble gold nanoparticles bearing diverse l-amino acid terminals have been fabricated and it is found that the hydrophilic side chains destabilize the ChT structure through either competitive hydrogen bonding or breakage of salt bridges, whereas denaturation was much slower with hydrophobic amino acid side chains.
Abstract: Water-soluble gold nanoparticles bearing diverse l-amino acid terminals have been fabricated to probe the effect of receptor surface on protein surface binding. The interaction of these nanoparticles with α-chymotrypsin (ChT) was investigated by activity assay, gel electrophoresis, zeta-potential, circular dichroism, and fluorescence spectroscopy. The results show that both electrostatic and hydrophobic interactions between the hydrophobic patches of receptors and the protein contribute to the stability of the complex. The microscopic binding constants for these receptor−protein systems are 106−107 M-1, with the capacity of the nanoparticle receptors to bind proteins determined by both their surface area and their surface charge density. Furthermore, it is found that the hydrophilic side chains destabilize the ChT structure through either competitive hydrogen bonding or breakage of salt bridges, whereas denaturation was much slower with hydrophobic amino acid side chains. Significantly, correlation betwee...
TL;DR: In this paper, the interaction between 1-hexylcarbamoyl-5-fluorouracil (Carmofur) and bovine serum albumin (BSA) was studied by spectroscopic methods including fluorescence spectroscopy, circular dichroism (CD) and UV-Visible absorption spectrum.
TL;DR: In this work, a water soluble chitosan with molecular weight of 5000 and deacetylated degree of 99% was selected to complex with DNA at varied charged ratios to eliminate the effect of the hydrophobicity of N-acetyl groups in chitOSan.
TL;DR: The kinetics and mode of nucleation and growth of fibers by 5α-cholestan-3β-yl N-(2-naphthyl)carbamate (CNC), a low-molecular mass organogelator (LMOG), in n-octane and n-dodecane have been investigated as their sols were transformed isothermally to organogels as discussed by the authors.
Abstract: The kinetics and mode of nucleation and growth of fibers by 5α-cholestan-3β-yl N-(2-naphthyl)carbamate (CNC), a low-molecular-mass organogelator (LMOG), in n-octane and n-dodecane have been investigated as their sols were transformed isothermally to organogels. The kinetics has been followed in detail by circular dichroism, fluorescence, small-angle neutron scattering, and rheological methods. When treated according to Avrami theory, kinetic data from the four methods are self-consistent and describe a gelation process involving one-dimensional growth and “instantaneous nucleation”. As expected from this growth model, polarized optical micrographs of the self-assembled fibrillar networks (SAFINs) show fibrous aggregates. However, their size and appearance change abruptly from spherulitic to rodlike as temperature is increased. This morphological change is attended by corresponding excursions in static and kinetic CD, fluorescence and rheological data. Furthermore, the rheological measurements reveal an un...
TL;DR: The aggregates, previously shown to be governed by the "sergeants-and-soldiers" principle when mixed with achiral analogues, are now also revealed to obey the "majority-rules" effect, a phenomenon not earlier observed in nonpolymers.
Abstract: C(3)-symmetrical disks 1, preorganized by acylated 2,2'-bipyridine-3,3'-diamine moieties and decorated with nine identical chiral, lipophilic tails, aggregate into a dynamic helix in apolar solvents. The aggregates, previously shown to be governed by the "sergeants-and-soldiers" principle when mixed with achiral analogues, are now also revealed to obey the "majority-rules" effect, a phenomenon not earlier observed in nonpolymers. Our experimental circular dichroism data can be accurately described with a recently developed theory. A fit of the theory to the experimental results shows that the mismatch penalty, i.e., the free energy of a monomer present in a helix of its nonpreferred screw sense (0.94 kJ/mol), is about 8 times lower than the penalty for a helix reversal (7.8 kJ/mol). This corresponds well to our vision of the supramolecular architecture of the disks.
TL;DR: Circular dichroism spectroscopy shows that changing the nanoparticle ligand dramatically influences the attached cytochrome c structure, which retains its structure with neutral ligands but denatures in the presence of charged species.
Abstract: We report the effect of nanoparticle ligand charge on the structure of a covalently, site-specifically linked protein. Au nanoparticles with positive, negative, and neutral ligands were appended to a specific cysteine, C102, of Saccharomyces cerevisiae cytochrome c. Conjugates were purified by HPLC or gel electrophoresis. Circular dichroism spectroscopy shows that changing the nanoparticle ligand dramatically influences the attached cytochrome c structure. The protein retains its structure with neutral ligands but denatures in the presence of charged species. This is rationalized by the electrostatic interaction of amino acids in the local vicinity of C102 with the endgroups of the ligand.
TL;DR: The absolute stereochemistry of the pentacyclic core in 2 and its new congener, citrinadin B, was elucidated by analysis of the ROESY spectrum for the chlorohydrin derivative of 1 as well as comparison of the electronic circular dichroism spectra for 1 and 2 with those of known spirooxiindole alkaloids.
Abstract: [Structure: see text]. Citrinadin A (2) is a pentacyclic indolinone alkaloid isolated from the cultured broth of a fungus, Penicillium citrinum, which was separated from a marine red alga. The absolute stereochemistry of the pentacyclic core in 2 and its new congener, citrinadin B (1), was elucidated by analysis of the ROESY spectrum for the chlorohydrin derivative (3) of 1 as well as comparison of the electronic circular dichroism (ECD) spectra for 1 and 2 with those of known spirooxiindole alkaloids. On the other hand, the absolute configuration at C-21 bearing an epoxide ring was assigned as S by comparison of the vibrational circular dichroism (VCD) spectra of 1 with those of model compounds 2S- and 2R-2,3-epoxy-3,3-dimethyl-1-phenylpropan-1-one (4a and 4b, respectively).
TL;DR: A detailed calculation of optical properties of reaction-center (D1-D2) complexes is presented applying a theory developed previously and evidence is provided for the accessory chlorophyll of the D1-branch as being the primary electron donor and the location of the triplet state at low temperatures.
TL;DR: Results show that HCV core protein behaves as a membranous protein and forms heterogeneous soluble micelle-like aggregates of high molecular weight in the absence of detergent, and it appears that the folding of the highly basic domain from positions 2 to 117 depends on the presence of the 117-169 hydrophobic domain, which contains the structural determinants ensuring the binding of core with cellular membranes.
Abstract: The building block of hepatitis C virus (HCV) nucleocapsid, the core protein, together with viral RNA, is composed of different domains involved in RNA binding and homo-oligomerization. The HCV core protein 1-169 (CHCV169) and its N-terminal region from positions 1 to 117 (CHCV117) were expressed in Escherichia coli and purified to homogeneity suitable for biochemical and biophysical characterizations. The overall conformation and the oligomeric properties of the resulting proteins CHCV169 and CHCV117 were investigated by using analytical centrifugation, circular dichroism, intrinsic fluorescence measurements, and limited proteolysis. Altogether, our results show that core protein (CHCV169) behaves as a membranous protein and forms heterogeneous soluble micelle-like aggregates of high molecular weight in the absence of detergent. In contrast, it behaves, in the presence of mild detergent, as a soluble, well-folded, noncovalent dimer. Similar to findings observed for core proteins of HCV-related flaviviruses, the HCV core protein is essentially composed of α-helices (50%). In contrast, CHCV117 is soluble and monodispersed in the absence of detergent but is unfolded. It appears that the folding of the highly basic domain from positions 2 to 117 (2-117 domain) depends on the presence of the 117-169 hydrophobic domain, which contains the structural determinants ensuring the binding of core with cellular membranes. Finally, our findings provide valuable information for further investigations on isolated core protein, as well as for attempts to reconstitute nucleocapsid particles in vitro.
TL;DR: In a low-concentration regime (1 mg/mL), PGM is still observed to exhibit effective aqueous lubricating properties under specific conditions of acidic pH and low ionic strength.
Abstract: We have investigated the influence of pH and ionic strength on the conformation of porcine gastric mucin (PGM) in bulk aqueous solution, its adsorption behavior onto poly(dimethylsiloxane) (PDMS) surfaces, and its lubricating behavior upon the self-mated sliding contact of a PDMS tribopair by means of circular dichroism (CD) spectroscopy, optical waveguide lightmode spectroscopy (OWLS), and pin-on-disk tribometry, respectively. In a low-concentration regime (1 mg/mL), where the formation of a mucus-gel is generally excluded, PGM is still observed to exhibit effective aqueous lubricating properties under specific conditions of acidic pH and low ionic strength. This behavior was closely correlated with specific conformations in the bulk solution as well as specific adsorption behavior at the water/PDMS interface. The lubrication mechanism of the self-mated sliding contact of PDMS by means of surface modification with PGM is discussed in terms of isoviscous-elastic/soft-elastohydrodynamic lubrication (soft-EHL).
TL;DR: The results indicate that pi-stacking interactions play an important role in peptide dispersion of SWNTs, and a series of peptides, based on the nano-1 sequence, in which the aromatic content is systematically varied are designed.
Abstract: We have previously demonstrated that a designed amphiphilic peptide helix, denoted nano-1, coats and debundles single-walled carbon nanotubes (SWNTs) and promotes the assembly of these coated SWNTs into novel hierarchical structures via peptide−peptide interactions. The purpose of this study is to better understand how aromatic content impacts interactions between peptides and SWNTs. We have designed a series of peptides, based on the nano-1 sequence, in which the aromatic content is systematically varied. Atomic force microscopy measurements and optical absorption spectroscopy reveal that the ability to disperse individual SWNTs increases with increasing aromatic residues in the peptide. Altogether, the results indicate that π-stacking interactions play an important role in peptide dispersion of SWNTs.
TL;DR: The mechanism for the induction of the chirality was confirmed using model compounds and the substituents were found to exist as a left-handed anti configuration in supramolecular polymers.
Abstract: α-Cyclodextrin with a p-t-butoxyaminocinnamoylamino group in the 3-position (3-p-tBocCiNH-α-CD) has been found to form a supramolecular polymer in an aqueous solution. The degree of polymerization of the supramolecular polymer is higher than 15 at 20 mM, as proved by VPO (vapor pressure osmometry) measurements and turbo ion spray TOF MS measurements. The existence of substitution/substitution interactions between adjacent monomers of the supramolecular polymer have been confirmed by the observation of positive and negative Cotton bands in circular dichroism spectra. The mechanism for the induction of the chirality was confirmed using model compounds. The substituents were found to exist as a left-handed anti configuration in supramolecular polymers. The supramolecular polymer was found to take a helical structure. The structure of the supramolecular polymer was observed by STM measurements.
TL;DR: Improved antioxidant efficacy of rutin was investigated, as affected by molecular encapsulation within beta-cyclodextrin (batophenanthroline test; comet assay; lipid peroxidation); the inclusion complex revealed improved antioxidant efficacy that may be in part explained by an increased solubility in the biological moiety.
TL;DR: The interaction between Jatrorrhizine with human serum albumin (HSA) were studied by fluorescence quenching technique, circular dichroism (CD) spectroscopy, and Fourier transform infrared (FT-IR) spectra, which indicated that hydrophobic and electrostatic interactions played a major role in the binding of J atrorrhIZine to HSA.
TL;DR: The results show that there are different conformational changes for cyt c adsorbed on gold nanoparticles with different sizes due to the different interaction forces between cyt c andgold nanoparticles.
TL;DR: The data suggest that the rate-limiting barrier for filament formation from full-length tau is conformational and that the aggregation reaction is triggered by environmental conditions that stabilize assembly-competent conformations.
Abstract: Alzheimer's disease is characterized in part by the accumulation of full-length tau proteins into intracellular filamentous inclusions. To clarify the events that trigger lesion formation, the aggregation of recombinant full-length four-repeat tau (htau40) was examined in vitro under near-physiological conditions using transmission electron microscopy and spectroscopy methods. In the absence of exogenous inducers, tau protein behaved as an assembly-incompetent monomer with little tertiary structure. The addition of anionic inducers led to fibrillization with nucleation-dependent kinetics. On the basis of circular dichroism spectroscopy and reactivity with thioflavin S and 8-anilino-1-naphthalenesulfonic acid fluorescent probes, the inducer stabilized a monomeric species with the folding characteristics of a premolten globule state. Planar aromatic dyes capable of binding the intermediate state with high affinity were also capable of triggering fibrillization in the absence of other inducers. Dye-mediated aggregation was characterized by concentration-dependent decreases in lag time, indicating increased nucleation rates, and submicromolar critical concentrations, indicating a final equilibrium that favored the filamentous state. The data suggest that the rate-limiting barrier for filament formation from full-length tau is conformational and that the aggregation reaction is triggered by environmental conditions that stabilize assembly-competent conformations.