Showing papers in "Immunogenetics in 2015"
TL;DR: An updated version of the state-of-the-art NetMHCIIpan method with improved peptide binding register identification is described, which significantly outperformed the earlier 3.0 version.
Abstract: A key event in the generation of a cellular response against malicious organisms through the endocytic pathway is binding of peptidic antigens by major histocompatibility complex class II (MHC class II) molecules. The bound peptide is then presented on the cell surface where it can be recognized by T helper lymphocytes. NetMHCIIpan is a state-of-the-art method for the quantitative prediction of peptide binding to any human or mouse MHC class II molecule of known sequence. In this paper, we describe an updated version of the method with improved peptide binding register identification. Binding register prediction is concerned with determining the minimal core region of nine residues directly in contact with the MHC binding cleft, a crucial piece of information both for the identification and design of CD4+ T cell antigens. When applied to a set of 51 crystal structures of peptide-MHC complexes with known binding registers, the new method NetMHCIIpan-3.1 significantly outperformed the earlier 3.0 version. We illustrate the impact of accurate binding core identification for the interpretation of T cell cross-reactivity using tetramer double staining with a CMV epitope and its variants mapped to the epitope binding core. NetMHCIIpan is publicly available at http://www.cbs.dtu.dk/services/NetMHCIIpan-3.1.
269 citations
TL;DR: It is demonstrated that relative quantitative comparison of endogenous peptides sampled from the authors' protein metabolism by HLA molecules provides clues to understand HLA association with disease.
Abstract: Celiac disease is caused by intolerance to cereal gluten proteins, and HLA-DQ molecules are involved in the disease pathogenesis by presentation of gluten peptides to CD4+ T cells. The α- or β-chain sharing HLA molecules DQ2.5, DQ2.2, and DQ7.5 display different risks for the disease. It was recently demonstrated that T cells of DQ2.5 and DQ2.2 patients recognize distinct sets of gluten epitopes, suggesting that these two DQ2 variants select different peptides for display. To explore whether this is the case, we performed a comprehensive comparison of the endogenous self-peptides bound to HLA-DQ molecules of B-lymphoblastoid cell lines. Peptides were eluted from affinity-purified HLA molecules of nine cell lines and subjected to quadrupole orbitrap mass spectrometry and MaxQuant software analysis. Altogether, 12,712 endogenous peptides were identified at very different relative abundances. Hierarchical clustering of normalized quantitative data demonstrated significant differences in repertoires of peptides between the three DQ variant molecules. The neural network-based method, NNAlign, was used to identify peptide-binding motifs. The binding motifs of DQ2.5 and DQ7.5 concurred with previously established binding motifs. The binding motif of DQ2.2 was strikingly different from that of DQ2.5 with position P3 being a major anchor having a preference for threonine and serine. This is notable as three recently identified epitopes of gluten recognized by T cells of DQ2.2 celiac patients harbor serine at position P3. This study demonstrates that relative quantitative comparison of endogenous peptides sampled from our protein metabolism by HLA molecules provides clues to understand HLA association with disease.
85 citations
TL;DR: The relationship between functional divergence and polymorphism of HLA molecules has never been shown before and it is shown that a single substitution in HLA-B molecules has more effect on the peptide-binding repertoire compared to that in Hla-A molecules.
Abstract: Human leukocyte antigen (HLA) genes are the most polymorphic genes in the human genome. Almost all polymorphic residues are located in the peptide-binding groove, resulting in different peptide-binding preferences. Whether a single amino acid change can alter the peptide-binding repertoire of an HLA molecule has never been shown. To experimentally quantify the contribution of a single amino acid change to the peptide repertoire of even a single HLA molecule requires an immense number of HLA peptide-binding measurements. Therefore, we used an in silico method to study the effect of single mutations on the peptide repertoires. We predicted the peptide-binding repertoire of a large set of HLA molecules and used the overlap of the peptide-binding repertoires of each pair of HLA molecules that differ on a single position to measure how much single substitutions change the peptide binding. We found that the effect of a single substitution in the peptide-binding groove depends on the substituted position and the amino acids involved. The positions that alter peptide binding most are the most polymorphic ones, while those that are hardly variable among HLA molecules have the lowest effect on the peptide repertoire. Although expected, the relationship between functional divergence and polymorphism of HLA molecules has never been shown before. Additionally, we show that a single substitution in HLA-B molecules has more effect on the peptide-binding repertoire compared to that in HLA-A molecules. This provides an (alternative) explanation for the larger polymorphism of HLA-B molecules compared to HLA-A molecules.
62 citations
TL;DR: Analysis of the sequences and genes of the known IL-17A/F andIL-17N molecules suggests that IL-13N is a member within the IL- 17A/f subfamily, while the potential involvement of these isoforms during responses post-vaccination and infection was studied.
Abstract: This study identifies four new IL-17A/F isoforms in salmonids, as well as IL-17N IL-17A/F1 and IL-17A/F2 are each represented by two paralogues, with a predicted pseudogene of IL-17N also apparent in the salmonid genome Analysis of the sequences and genes of the known IL-17A/F and IL-17N molecules suggests that IL-17N is a member within the IL-17A/F subfamily Analysis of factors that modulated the expression of these genes showed that PHA and PMA were good inducers of salmon IL-17A/F1a and IL-17A/F2a, with rIL-21 a potent stimulator of IL-17A/F1a and IL-17A/F3 The potential involvement of these isoforms during responses post-vaccination and infection was also studied In unvaccinated control fish, Yersinia ruckeri infection resulted in a marked up-regulation of IL-17A/F1a and IL-17N in the spleen and head kidney and IL-17A/F2a and IL-17A/F3 in the spleen In the vaccinated fish, only one significant increase was seen relative to control fish, of IL-17A/F2a in the gills, whether the fish were challenged with Y ruckeri or given the saline placebo It was also apparent in the gills and head kidney that the level of IL-17A/F1b remained elevated in the Y ruckeri-challenged fish at a time when it had decreased in saline-injected fish The relative importance of these isoforms for disease resistance remains to be determined
53 citations
TL;DR: It is concluded that differently from HLA-A, for which supertype and allelic variation show similar patterns of nucleotide diversity within and between populations, Hla-B has likely evolved through specific adaptations of its B pocket to local pathogens.
Abstract: Supertypes are groups of human leukocyte antigen (HLA) alleles which bind overlapping sets of peptides due to sharing specific residues at the anchor positions—the B and F pockets—of the peptide-binding region (PBR). HLA alleles within the same supertype are expected to be functionally similar, while those from different supertypes are expected to be functionally distinct, presenting different sets of peptides. In this study, we applied the supertype classification to the HLA-A and HLA-B data of 55 worldwide populations in order to investigate the effect of natural selection on supertype rather than allelic variation at these loci. We compared the nucleotide diversity of the B and F pockets with that of the other PBR regions through a resampling procedure and compared the patterns of within-population heterozygosity (He) and between-population differentiation (GST) observed when using the supertype definition to those estimated when using randomized groups of alleles. At HLA-A, low levels of variation are observed at B and F pockets and randomized He and GST do not differ from the observed data. By contrast, HLA-B concentrates most of the differences between supertypes, the B pocket showing a particularly high level of variation. Moreover, at HLA-B, the reassignment of alleles into random groups does not reproduce the patterns of population differentiation observed with supertypes. We thus conclude that differently from HLA-A, for which supertype and allelic variation show similar patterns of nucleotide diversity within and between populations, HLA-B has likely evolved through specific adaptations of its B pocket to local pathogens.
44 citations
TL;DR: Large scale genetic screening of the Filipino macaque population would identify high-frequency Mafa-class I haplotypes that could be used as MHC control animals for the benefit of biomedical research.
Abstract: Although the low polymorphism of the major histocompatibility complex (MHC) transplantation genes in the Filipino cynomolgus macaque (Macaca fascicularis) is expected to have important implications in the selection and breeding of animals for medical research, detailed polymorphism information is still lacking for many of the duplicated class I genes. To better elucidate the degree and types of MHC polymorphisms and haplotypes in the Filipino macaque population, we genotyped 127 unrelated animals by the Sanger sequencing method and high-resolution pyrosequencing and identified 112 different alleles, 28 at cynomolgus macaque MHC (Mafa)-A, 54 at Mafa-B, 12 at Mafa-I, 11 at Mafa-E, and seven at Mafa-F alleles, of which 56 were newly described. Of them, the newly discovered Mafa-A8*01:01 lineage allele had low nucleotide similarities (<86%) with primate MHC class I genes, and it was also conserved in the Vietnamese and Indonesian populations. In addition, haplotype estimations revealed 17 Mafa-A, 23 Mafa-B, and 12 Mafa-E haplotypes integrated with 84 Mafa-class I haplotypes and Mafa-F alleles. Of these, the two Mafa-class I haplotypes, F/A/E/B-Hp1 and F/A/E/B-Hp2, had the highest haplotype frequencies at 10.6 and 10.2%, respectively. This suggests that large scale genetic screening of the Filipino macaque population would identify these and other high-frequency Mafa-class I haplotypes that could be used as MHC control animals for the benefit of biomedical research.
42 citations
TL;DR: The in vivo whole-cell proteolysis was best predicted by a method trained on MHC-I ligand data (NetChop Cterm), and follow-up analysis showed that the likely source of this difference is the activity from proteases other than the proteasome, such as TPPII.
Abstract: Proteolysis is the general term to describe the process of protein degradation into peptides. Proteasomes are the main actors in cellular proteolysis, and their activity can be measured in in vitro digestion experiments. However, in vivo proteolysis can be different than what is measured in these experiments if other proteases participate or if proteasomal activity is different in vivo. The in vivo proteolysis can be measured only indirectly, by the analysis of peptides presented on MHC-I molecules. MHC-I presented peptides are protected from further degradation, thus enabling an indirect view on the underlying in vivo proteolysis. The ligands presented on different MHC-I molecules enable different views on this process; in combination, they might give a complete picture. Based on in vitro proteasome-only digestions and MHC-I ligand data, different proteolysis predictors have been developed. With new in vitro digestion and MHC-I ligand data sets, we benchmarked how well these predictors capture in vitro proteasome-only activity and in vivo whole-cell proteolysis, respectively. Even though the in vitro proteasome digestion patterns were best captured by methods trained on such data (ProteaSMM and NetChop 20S), the in vivo whole-cell proteolysis was best predicted by a method trained on MHC-I ligand data (NetChop Cterm). Follow-up analysis showed that the likely source of this difference is the activity from proteases other than the proteasome, such as TPPII. This non-proteasomal in vivo activity is captured by NetChop Cterm and should be taken into account in MHC-I ligand predictions.
40 citations
TL;DR: This paper investigated the molecular mechanisms of AFB1 immunotoxicity and the ability of a Lactobacillus-based probiotic to protect against aflatoxicosis in the domestic turkey.
Abstract: Poultry are highly susceptible to the immunotoxic effects of the food-borne mycotoxin aflatoxin B1 (AFB1). Exposure impairs cell-mediated and humoral immunity, limits vaccine efficacy, and increases the incidence of costly secondary infections. We investigated the molecular mechanisms of AFB1 immunotoxicity and the ability of a Lactobacillus-based probiotic to protect against aflatoxicosis in the domestic turkey (Meleagris gallopavo). The spleen transcriptome was examined by RNA sequencing (RNA-seq) of 12 individuals representing four treatment groups. Sequences (6.9 Gb) were de novo assembled to produce over 270,000 predicted transcripts and transcript fragments. Differential expression analysis identified 982 transcripts with statistical significance in at least one comparison between treatment groups. Transcripts with known immune functions comprised 27.6 % of significant expression changes in the AFB1-exposed group. Short exposure to AFB1 suppressed innate immune transcripts, especially from antimicrobial genes, but increased the expression of transcripts from E3 ubiquitin-protein ligase CBL-B and multiple interleukin-2 response genes. Up-regulation of transcripts from lymphotactin, granzyme A, and perforin 1 could indicate either increased cytotoxic potential or activation-induced cell death in the spleen during aflatoxicosis. Supplementation with probiotics was found to ameliorate AFB1-induced expression changes for multiple transcripts from antimicrobial and IL-2-response genes. However, probiotics had an overall suppressive effect on immune-related transcripts.
26 citations
TL;DR: Data indicate not only that genetic variation in APM component genes is associated with cervical carcinoma risk in Indonesia but also that the patterns of association differ depending on background genetic composition and possibly on differences in HPV type distribution.
Abstract: Genetic variation of antigen-processing machinery (APM) components has been shown to be associated with cervical carcinoma risk and outcome in a genetically homogeneous Dutch population. However, the role of APM component single nucleotide polymorphisms (SNPs) in genetically heterogeneous populations with different distributions of human papillomavirus (HPV) subtypes remains unclear. Eleven non-synonymous, coding SNPs in the TAP1, TAP2, LMP2, LMP7 and ERAP1 genes were genotyped in cervical carcinoma patients and healthy controls from two distinct Indonesian populations (Balinese and Javanese). Individual genotype and allele distributions were investigated using single-marker analysis, and combined SNP effects were assessed by haplotype construction and haplotype interaction analysis. Allele distribution patterns in Bali and Java differed in relation to cervical carcinoma risk, with four ERAP1 SNPs and one TAP2 SNP in the Javanese population showing significant association with cervical carcinoma risk, while in the Balinese population, only one TAP2 SNP showed this association. Multimarker analysis demonstrated that in the Javanese patients, one specific haplotype, consisting of the ERAP1-575 locus on chromosome 5 and the TAP2-379 and TAP2-651 loci on chromosome 6, was significantly associated with cervical carcinoma risk (global P = 0.008); no significant haplotype associations were found in the Balinese population. These data indicate not only that genetic variation in APM component genes is associated with cervical carcinoma risk in Indonesia but also that the patterns of association differ depending on background genetic composition and possibly on differences in HPV type distribution.
26 citations
TL;DR: The set of conserved immune response genes of the Caribbean reef-building coral Pseudodiploria strigosa are analyzed by Illumina-based transcriptome sequencing and annotation of healthy colonies challenged with whole live Gram-positive and Gram-negative bacteria.
Abstract: The viability of coral reefs worldwide has been seriously compromised in the last few decades due in part to the emergence of coral diseases of infectious nature. Despite important efforts to understand the etiology and the contribution of environmental factors associated to coral diseases, the mechanisms of immune response in corals are just beginning to be studied systematically. In this study, we analyzed the set of conserved immune response genes of the Caribbean reef-building coral Pseudodiploria strigosa by Illumina-based transcriptome sequencing and annotation of healthy colonies challenged with whole live Gram-positive and Gram-negative bacteria. Searching the annotated transcriptome with immune-related terms yielded a total of 2782 transcripts predicted to encode conserved immune-related proteins that were classified into three modules: (a) the immune recognition module, containing a wide diversity of putative pattern recognition receptors including leucine-rich repeat-containing proteins, immunoglobulin superfamily receptors, representatives of various lectin families, and scavenger receptors; (b) the intracellular signaling module, containing components from the Toll-like receptor, transforming growth factor, MAPK, and apoptosis signaling pathways; and (3) the effector module, including the C3 and factor B complement components, a variety of proteases and protease inhibitors, and the melanization-inducing phenoloxidase. P. strigosa displays a highly variable and diverse immune recognition repertoire that has likely contributed to its resilience to coral diseases.
25 citations
TL;DR: CD1 genes in the green anole lizard and Crocodylia are described, demonstrating that CD1 is ubiquitous in mammals, birds, and reptiles and providing new insights for studying the origin and evolution of CD1.
Abstract: CD1, as the third family of antigen-presenting molecules, is previously only found in mammals and chickens, which suggests that the chicken and mammalian CD1 shared a common ancestral gene emerging at least 310 million years ago. Here, we describe CD1 genes in the green anole lizard and Crocodylia, demonstrating that CD1 is ubiquitous in mammals, birds, and reptiles. Although the reptilian CD1 protein structures are predicted to be similar to human CD1d and chicken CD1.1, CD1 isotypes are not found to be orthologous between mammals, birds, and reptiles according to phylogenetic analyses, suggesting an independent diversification of CD1 isotypes during the speciation of mammals, birds, and reptiles. In the green anole lizard, although the single CD1 locus and MHC I gene are located on the same chromosome, there is an approximately 10-Mb-long sequence in between, and interestingly, several genes flanking the CD1 locus belong to the MHC paralogous region on human chromosome 19. The CD1 genes in Crocodylia are located in two loci, respectively linked to the MHC region and MHC paralogous region (corresponding to the MHC paralogous region on chromosome 19). These results provide new insights for studying the origin and evolution of CD1.
TL;DR: A significantly higher prevalence of homozygosity for DQA1*01:02 was found in HLA-DQB1*06:02 heterozygous patients compared to controls and this finding clearly supports a direct role of the Hla-DQ molecule in the development of disease.
Abstract: Narcolepsy with cataplexy is a sleep disorder caused by the loss of hypocretin-producing neurons in the hypothalamus. It is tightly associated with a specific human leukocyte antigen (HLA)-allele: HLA-DQB1*06:02. Based on this, an autoimmune process has been hypothesized. A functional HLA-DQ molecule consists of a DQα and a DQβ chain. HLA-DQB1*06:02 (DQβ) has a strong preference for binding to HLA-DQA1*01:02 (DQα), and together they form the functional DQ0602 dimer. A dosage effect would be expected if the HLA-DQ0602 dimer itself is directly involved in the aetiology. An increased expression of the HLA-DQ0602 dimer is expected in individuals homozygous for HLA-DQB1*06:02-DQA1*01:02, but is also hypothesized in individuals heterozygous for HLA-DQB1*06:02 and homozygous for HLA-DQA1*01:02. To study the impact of the expression of the HLA-DQ0602 dimer on narcolepsy susceptibility, 248 Dutch narcolepsy patients and 1272 Dutch control subjects, all of them positive for DQB1*06:02 (heterozygous and homozygous), were HLA-genotyped with attention not only to DQB1 but also to DQA1*01:02. DQB1*06:02-DQA1*01:02 homozygosity was significantly more often seen in patients compared to controls (O.R. 2.29) confirming previous observations. More importantly, a significantly higher prevalence of homozygosity for DQA1*01:02 was found in HLA-DQB1*06:02 heterozygous patients compared to controls (O.R. 2.37, p < 0.001). The latter finding clearly supports a direct role of the HLA-DQ molecule in the development of disease.
TL;DR: The Tasmanian devil is an endangered marsupial species that has survived several historical bottlenecks and now has low genetic diversity, and concerns remain for the long-term survival of this species.
Abstract: The Tasmanian devil is an endangered marsupial species that has survived several historical bottlenecks and now has low genetic diversity. Here we characterize the Toll-like receptor (TLR) genes and their diversity in the Tasmanian devil. TLRs are a key innate immune gene family found in all animals. Ten TLR genes were identified in the Tasmanian devil genome. Unusually low levels of diversity were found in 25 devils from across Tasmania. We found two alleles at TLR2, TLR3 and TLR6. The other seven genes were monomorphic. The insurance population, which safeguards the species from extinction, has successfully managed to capture all of these TLR alleles, but concerns remain for the long-term survival of this species.
TL;DR: The data suggest that Kir2DS5 may be associated with protection from endometriosis, whereas KIR2DS4del seems to beassociated with higher disease stages, possibly by exclusion of protective KIR1DS5.
Abstract: Endometriosis is defined as the presence of functional endometrial tissue outside the uterine cavity. Several hypotheses have attempted to explain the etiology and pathogenesis of endometriosis. Recently, it has been suggested that a defect of the natural killer (NK) activity in the recognition and lysis of endometrial cells is one of the crucial points in the development of this disease. Natural killer cells can express killer immunoglobulin-like receptors (KIR), which recognize class I human leukocyte antigens on target cells. We asked whether polymorphisms in KIR, HLA-C, and HLA-B genes are risk factors for endometriosis. We tested 153 women with endometriosis diagnosed on the basis of laparoscopic and histological examination, and 213 control healthy women, who gave birth to at least one child. The frequency of KIR genes in patients was similar to that in controls except for KIR2DS5, which exerted a protective effect only in HLA-C C2-positive individuals. Moreover, KIR2DS5-positive women with endometriosis had 13 times lower chance that the disease would occupy the peritoneum than KIR2DS5- and KIR2DS4del-negative ones (OR = 0.077, P = 0.0061). Similarly, KIR2DS4del-positive endometriotic persons had 11 times lower chance for peritoneal disease (OR = 0.094, P < 0.001). Negative linkage disequilibrium between KIR2DS5 and KIR2DS4del indicates that these genes are mutually exclusive. Our data suggest that KIR2DS5 may be associated with protection from endometriosis, whereas KIR2DS4del seems to be associated with higher disease stages, possibly by exclusion of protective KIR2DS5.
TL;DR: The data indicate that the robust HLA-B/MICA association may be explained by a single variant between the two genes, and contribute to a better appraisal of the intriguing linkage between BD and the ancient Silk Route.
Abstract: Despite that the association of Behcet’s disease (BD) with the HLA-B5 was first established in the 1970s, a number of recent genome-wide association studies have both confirmed and furthered this association—in various populations—to individual SNPs both inside and outside the HLA. The former include HLA-B, MICA, and HLA-A, while the latter encompass IL10 and IL23R-IL12RB2 regions. The present study examined whether some of these SNPs could be replicated in an Iranian population, where the prevalence of disease is amply documented. Eight SNPs were selected and tested in 552 patients and 417 controls. These were rs7539328, rs12119179, rs1495965, rs1518111, and rs1800871 in IL10 and IL23R-IL12RB2 regions and rs114854070, rs12525170, and rs76546355 (formerly rs116799036) in the HLA locus. The well-known BD-associated genes HLA-B and MICA were independently genotyped. Although we were not able to formally replicate the association with IL10 and IL23R-IL12RB2, we do report that BD in Iran is strongly associated with HLA-B*51, MICA-A6, and the three HLA-linked SNPs (odds ratio (OR) = 3.38, P = 6.21 × 10−14; OR = 2.08, P = 1.58 × 10−13; and OR = 1.67–4.05, P = 1.45 × 10−04 to 4.79 × 10−34, respectively). Our data further indicate that the robust HLA-B/MICA association may be explained by a single variant (rs76546355) between the two genes. Overall, these data contribute to a better appraisal of the intriguing linkage between BD and the ancient Silk Route, spanning from the Mediterranean shores to Japan.
TL;DR: These efforts have produced full-length sequences for potentially important immune genes in koala, which should serve as targets for future investigations that aim to conserve koala populations.
Abstract: The study of the koala transcriptome has the potential to advance our understanding of its immunome—immunological reaction of a given host to foreign antigens—and to help combat infectious diseases (e.g., chlamydiosis) that impede ongoing conservation efforts. We used Illumina sequencing of cDNA to characterize genes expressed in two different koala tissues of immunological importance, blood and spleen. We generated nearly 600 million raw sequence reads, and about 285 million of these were subsequently assembled and condensed into ~70,000 subcomponents that represent putative transcripts. We annotated ~16 % of these subcomponents and identified those related to infection and the immune response, including Toll-like receptors (TLRs), RIG-I-like receptors (RLRs), major histocompatibility complex (MHC) genes, and koala retrovirus (KoRV). Using phylogenetic analyses, we identified 29 koala genes in these target categories and report their concordance with currently accepted gene groups. By mapping multiple sequencing reads to transcripts, we identified 56 putative SNPs in genes of interest. The distribution of these SNPs indicates that MHC genes (34 SNPs) are more diverse than KoRV (12 SNPs), TLRs (8 SNPs), or RLRs (2 SNPs). Our sequence data also indicate that KoRV sequences are highly expressed in the transcriptome. Our efforts have produced full-length sequences for potentially important immune genes in koala, which should serve as targets for future investigations that aim to conserve koala populations.
TL;DR: The observations suggest that the A3H with low anti-HIV-1 activity, A 3H-hapC, is associated with the susceptibility to HIV-1 infection, whereas the A2H producing a stable protein, A3h-hapB, may confer a low risk of disease progression to AIDS.
Abstract: Human APOBEC3H (A3H) is a member of APOBEC3 cytidine deaminase family that potently restricts HIV-1 replication. Because A3H is genetically divergent with different intracellular stability and anti-HIV-1 activity in vitro, we investigated a possible association of A3H with susceptibility to HIV-1 infection and disease progression in Japanese populations. A total of 191 HIV-1-infected individuals (HIV group), 93 long-term non-progressors to AIDS (LTNP group) and 421 healthy controls were genotyped for two functional APOBEC3H polymorphisms, rs139292 and rs139297. As compared with the controls, minor allele frequency (MAF) for rs139292 was high in the HIV group (MAF in cases vs. controls; 0.322 vs. 0.263, odds ratio (OR) = 1.33, 95 % confidence interval (95 % CI) = 1.02–1.74, p = 0.035) and low in the LTNP group (0.161 vs. 0.263, OR = 0.54, 95 % CI = 0.36–0.82, p = 0.004, pc = 0.007), whereas the MAF for rs139297 was high in the HIV group (0.367 vs. 0.298, OR = 1.36, 95 % CI = 1.07–1.76, p = 0.017, pc = 0.035). In addition, haplotype analyses revealed that the frequencies of A3H-hapC and -hapA were high (0.322 vs. 0.262, OR = 1.33, 95% CI = 1.02–1.74, p = 0.003) and low (0.634 vs. 0.697, OR = 0.75, 95 % CI = 0.58–0.97, p = 0.002), respectively, in the HIV group, whereas the frequencies of A3H-hapC and -hapB were low (0.161 vs. 0.262, OR = 0.54, 95 % CI = 0.36–0.82, p = 0.00003) and high (0.097 vs. 0.040, OR = 2.55, 95 % CI = 1.40–4.62, p = 0.000008), respectively, in the LTNP group, as compared with those in the controls. These observations suggest that the A3H with low anti-HIV-1 activity, A3H-hapC, is associated with the susceptibility to HIV-1 infection, whereas the A3H producing a stable protein, A3H-hapB, may confer a low risk of disease progression to AIDS.
TL;DR: There is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine.
Abstract: The observed heterogeneity in rubella-specific immune response phenotypes post-MMR vaccination is thought to be explained, in part, by inter-individual genetic variation. In this study, single nucleotide polymorphisms (SNPs) and multiple haplotypes in several candidate genes were analyzed for associations with more than one rubella-specific immune response outcome, including secreted IFN-γ, secreted IL-6, and neutralizing antibody titers. Overall, we identified 23 SNPs in 10 different genes that were significantly associated with at least two rubella-specific immune responses. Of these SNPs, we detected eight in the PVRL3 gene, five in the PVRL1 gene, one in the TRIM22 gene, two in the IL10RB gene, two in the TLR4 gene, and five in other genes (PVR, ADAR, ZFP57, MX1, and BTN2A1/BTN3A3). The PVRL3 gene haplotype GACGGGGGCAGCAAAAAGAAGAGGAAAGAACAA was significantly associated with both higher IFN-γ secretion (t-statistic 4.43, p < 0.0001) and higher neutralizing antibody titers (t-statistic 3.14, p = 0.002). Our results suggest that there is evidence of multigenic associations among identified gene SNPs and that polymorphisms in these candidate genes contribute to the overall observed differences between individuals in response to live rubella virus vaccine. These results will aid our understanding of mechanisms behind rubella-specific immune response to MMR vaccine and influence the development of vaccines in the future.
TL;DR: This study represents a first step toward unravelling factors influencing the adaptive divergence of MHC genes between closely related but ecologically differentiated sympatric lemurs and opens new questions regarding potential functional discrepancy that would explain contrasting selection patterns detected at DQB.
Abstract: The polymorphism of immunogenes of the major histocompatibility complex (MHC) is thought to influence the functional plasticity of immune responses and, consequently, the fitness of populations facing heterogeneous pathogenic pressures. Here, we evaluated MHC variation (allelic richness and divergence) and patterns of selection acting on the two highly polymorphic MHC class II loci (DRB and DQB) in the endangered primate Madame Berthe’s mouse lemur (Microcebus berthae). Using 454 pyrosequencing, we examined MHC variation in a total of 100 individuals sampled over 9 years in Kirindy Forest, Western Madagascar, and compared our findings with data obtained previously for its sympatric congener, the grey mouse lemur (Microcebus murinus). These species exhibit a contrasting ecology and demography that were expected to affect MHC variation and molecular signatures of selection. We found a lower allelic richness concordant with its low population density, but a similar level of allelic divergence and signals of historical selection in the rare feeding specialist M. berthae compared to the widespread generalist M. murinus. These findings suggest that demographic factors may exert a stronger influence than pathogen-driven selection on current levels of allelic richness in M. berthae. Despite a high sequence similarity between the two congeners, contrasting selection patterns detected at DQB suggest its potential functional divergence. This study represents a first step toward unravelling factors influencing the adaptive divergence of MHC genes between closely related but ecologically differentiated sympatric lemurs and opens new questions regarding potential functional discrepancy that would explain contrasting selection patterns detected at DQB.
TL;DR: The information obtained from this study indicates a high MHC genetic diversity and the association of MHC alleles with important production traits in Khorasan chicken, which would be applicable in designing breeding and genetic resource conservation for indigenous chicken populations.
Abstract: Major histocompatibility complex (MHC) is the best characterized genetic region controlling disease resistance and immune responses in chicken. MHC genes are also involved in various non-immune functions such as productive traits and reproductive success. The genetic diversity of MHC in an Iranian indigenous chicken (Khorasan) was studied, and association of the MHC alleles with production traits was determined. The MHC polymorphism was ascertained by genotyping the LEI0258 microsatellite locus by PCR-based fragment analysis. LEI0258 microsatellite marker is a genetic indicator for MHC, which is located on microchromosome 16 and strongly associated with serologically defined MHC haplotypes. A total of 25 different LEI0258 alleles (185–493 bp) and 76 genotypes were identified in 313 chickens. An allele of 361 bp had the highest frequency (26.44 %), and alleles of 207 and 262 bp had the lowest (0.16 %). High level of heterozygosity (87 %) and good genotype frequency fit to the Hardy–Weinberg equilibrium was observed in this population (P = 0.238). The association study also revealed a significant influence of MHC alleles on body weight, egg weight, egg laying intensity, and weight of sexual maturity in Khorasan population (P < 0.05). The information obtained from this study indicates a high MHC genetic diversity and the association of MHC alleles with important production traits in Khorasan chicken. These data would be applicable in designing breeding and genetic resource conservation for indigenous chicken populations.
TL;DR: The results of these analyses showed that BoLA alleles cluster into three distinct groups with the potential to define “BoLA supertypes,” which provides insight into T cell immunity following infection or vaccination.
Abstract: Major histocompatibility complex (MHC) class I molecules regulate adaptive immune responses through the presentation of antigenic peptides to CD8+ T cells. Polymorphisms in the peptide binding region of class I molecules determine peptide binding affinity and stability during antigen presentation, and different antigen peptide motifs are associated with specific genetic sequences of class I molecules. Understanding bovine leukocyte antigen (BoLA), peptide-MHC class I binding specificities may facilitate development of vaccines or reagents for quantifying the adaptive immune response to intracellular pathogens, such as foot-and-mouth disease virus (FMDV). Six synthetic BoLA class I (BoLA-I) molecules were produced, and the peptide binding motif was generated for five of the six molecules using a combined approach of positional scanning combinatorial peptide libraries (PSCPLs) and neural network-based predictions (NetMHCpan). The updated NetMHCpan server was used to predict BoLA-I binding peptides within the P1 structural polyprotein sequence of FMDV (strain A24 Cruzeiro) for BoLA-1*01901, BoLA-2*00801, BoLA-2*01201, and BoLA-4*02401. Peptide binding affinity and stability were determined for these BoLA-I molecules using the luminescent oxygen channeling immunoassay (LOCI) and scintillation proximity assay (SPA). The functional diversity of known BoLA alleles was predicted using the MHCcluster tool, and functional predictions for peptide motifs were compared to observed data from this and prior studies. The results of these analyses showed that BoLA alleles cluster into three distinct groups with the potential to define “BoLA supertypes.” This streamlined approach identifies potential T cell epitopes from pathogens, such as FMDV, and provides insight into T cell immunity following infection or vaccination.
Aristotle University of Thessaloniki1, Uppsala University2, University of Montpellier3, University of Padua4, National and Kapodistrian University of Athens5, Erasmus University Rotterdam6, Masaryk University7, Mayo Clinic8, Royal Bournemouth Hospital9, North Shore-LIJ Health System10, Vita-Salute San Raffaele University11
TL;DR: Recent changes in the IMGT reference directories affected the interpretation of SHM in a sizeable number of IGH rearrangement sequences from CLL patients, indicating that both physicians and researchers should consider a re-evaluation of IG sequence data, especially for those I GH rearrangements that, up to date, have a GI close to 98 %, where caution is warranted.
Abstract: Νext generation sequencing studies in Homo sapiens have identified novel immunoglobulin heavy variable (IGHV) genes and alleles necessitating changes in the international ImMunoGeneTics information system (IMGT) GENE-DB and reference directories of IMGT/V-QUEST. In chronic lymphocytic leukaemia (CLL), the somatic hypermutation (SHM) status of the clonotypic rearranged IGHV gene is strongly associated with patient outcome. Correct determination of this parameter strictly depends on the comparison of the nucleotide sequence of the clonotypic rearranged IGHV gene with that of the closest germline counterpart. Consequently, changes in the reference directories could, in principle, affect the correct interpretation of the IGHV mutational status in CLL. To this end, we analyzed 8066 productive IG heavy chain (IGH) rearrangement sequences from our consortium both before and after the latest update of the IMGT/V-QUEST reference directory. Differences were identified in 405 cases (5 % of the cohort). In 291/405 sequences (71.9 %), changes concerned only the IGHV gene or allele name, whereas a change in the percent germline identity (%GI) was noted in 114/405 (28.1 %) sequences; in 50/114 (43.8 %) sequences, changes in the %GI led to a change in the mutational set. In conclusion, recent changes in the IMGT reference directories affected the interpretation of SHM in a sizeable number of IGH rearrangement sequences from CLL patients. This indicates that both physicians and researchers should consider a re-evaluation of IG sequence data, especially for those IGH rearrangement sequences that, up to date, have a GI close to 98 %, where caution is warranted.
TL;DR: This study shows that the 454 NGS platform is an efficient method for screening individual MHC variation across large datasets in Berthelot’s pipit, and provides data that can be used in future studies investigating spatio-temporal patterns and scales of selection on the MHC.
Abstract: Genes of the major histocompatibility complex (MHC) code for receptors that are central to the adaptive immune response of vertebrates. These genes are therefore important genetic markers with which to study adaptive genetic variation in the wild. Next-generation sequencing (NGS) has increasingly been used in the last decade to genotype the MHC. However, NGS methods are highly prone to sequencing errors, and although several methodologies have been proposed to deal with this, until recently there have been no standard guidelines for the validation of putative MHC alleles. In this study, we used the 454 NGS platform to screen MHC class I exon 3 variation in a population of the island endemic Berthelot's pipit (Anthus berthelotii). We were able to characterise MHC genotypes across 309 individuals with high levels of repeatability. We were also able to determine alleles that had low amplification efficiencies, whose identification within individuals may thus be less reliable. At the population level we found lower levels of MHC diversity in Berthelot's pipit than in its widespread continental sister species the tawny pipit (Anthus campestris), and observed trans-species polymorphism. Using the sequence data, we identified signatures of gene conversion and evidence of maintenance of functionally divergent alleles in Berthelot's pipit. We also detected positive selection at 10 codons. The present study therefore shows that we have an efficient method for screening individual MHC variation across large datasets in Berthelot's pipit, and provides data that can be used in future studies investigating spatio-temporal patterns and scales of selection on the MHC.
TL;DR: The results indicate that chicken lack immunoproteasomes also on protein level, substantiated by the finding that 20S proteasomes isolated from immune and non-immune tissues showed very similar peptidolytic activities.
Abstract: The proteasome is the main protein-degrading machine within the cell, producing ligands for MHC class I molecules. It is a cylindrical multicatalytic protease complex, and the catalytic activity is mediated by the three subunits β1, β2, and β5 which possess caspase-, trypsin-, and chymotrypsin-like activities, respectively. By stimulation with interferon (IFN)-γ the replacement of these subunits by β1i, β2i, and β5i is induced leading to formation of immunoproteasomes with altered proteolytic and antigen processing properties. The genes coding for these immunosubunits are restricted to jawed vertebrates but have so far not been found in the genomes of birds, e.g., chicken, turkey, quail, black grouse and zebra finch. However, the chicken genome sequences are not completely assigned; therefore, we investigated the presence of immunoproteasome on protein level. 20S proteasome was purified from the chicken brain, blood, spleen, and bursa of Fabricius, followed by separation via two-dimensional (2D) gel electrophoresis. We analyzed the protein spots derived from the spleen and brain by mass spectrometry and could identify all 14 proteasomal subunits, but there were no differences detectable in the spot patterns. Moreover, we stimulated the chicken spleen cells with phorbol 12-myristate 13-acetate (PMA) and ionomycin aiming at the induction of immunoproteasome, but in spite of the induction of proliferation and IFN-γ, no evidence for immunoproteasome formation in chicken could be obtained. This result was substantiated by the finding that 20S proteasomes isolated from immune and non-immune tissues showed very similar peptidolytic activities. Taken together, our results indicate that chicken lack immunoproteasomes also on protein level.
TL;DR: The developed GeneTiles software can improve RNAseq analysis approaches by more confidently identifying a large set of markers upon infection with Staphylococcus epidermidis and Mycobacterium marinum bacteria, and this approach will be highly useful for transcriptome analyses of other organisms for which well-characterised genomes are available.
Abstract: We present a RNA deep sequencing (RNAseq) analysis of a comparison of the transcriptome responses to infection of zebrafish larvae with Staphylococcus epidermidis and Mycobacterium marinum bacteria. We show how our developed GeneTiles software can improve RNAseq analysis approaches by more confidently identifying a large set of markers upon infection with these bacteria. For analysis of RNAseq data currently, software programs such as Bowtie2 and Samtools are indispensable. However, these programs that are designed for a LINUX environment require some dedicated programming skills and have no options for visualisation of the resulting mapped sequence reads. Especially with large data sets, this makes the analysis time consuming and difficult for non-expert users. We have applied the GeneTiles software to the analysis of previously published and newly obtained RNAseq datasets of our zebrafish infection model, and we have shown the applicability of this approach also to published RNAseq datasets of other organisms by comparing our data with a published mammalian infection study. In addition, we have implemented the DEXSeq module in the GeneTiles software to identify genes, such as glucagon A, that are differentially spliced under infection conditions. In the analysis of our RNAseq data, this has led to the possibility to improve the size of data sets that could be efficiently compared without using problem-dedicated programs, leading to a quick identification of marker sets. Therefore, this approach will also be highly useful for transcriptome analyses of other organisms for which well-characterised genomes are available.
TL;DR: It is found that IL-17 F (rs763780) polymorphism was associated with a decreased risk of RPL in Egyptian females, and it is demonstrated that both the IL- 17 and leptin levels were elevated in the women with RPL and in an obese subgroup within RPLIn comparison to a lean one.
Abstract: Recurrent pregnancy loss (RPL) is a common problem during early gestation. The aim of our study was to investigate the association of IL-17 F( rs763780), IL-17 A (rs2275913), and leptin (2548 G/A) gene polymorphisms with RPL in obese and lean Egyptian females, and to find out whether these gene polymorphisms affect the women’s serum levels. One hundred and twenty patients with RPL and 120 fertile volunteers with no history of pregnancy loss were genotyped for leptin (2548 G/A), IL-17 A (rs2275913), and IL-17 F (rs763780) polymorphisms by RFLP. The serum level of IL-17 was measured by ELISA, while serum leptin level was measured by HPLC. We found that IL-17 F (rs763780) polymorphism was associated with a decreased risk of RPL in Egyptian females, and we also found that IL-17 A (rs2275913) and LEP (2548 G/A) SNP were associated with an increased risk of RPL. We also demonstrated that both the IL-17 and leptin levels were elevated in the women with RPL and in an obese subgroup within RPL in comparison to a lean one.
TL;DR: Genetic variation at DQA, DQB, DRA, and DRB loci in dolphins from central-west Florida and the Florida Panhandle provides evidence that selective pressures at the MHC vary among dolphin populations that differ in the frequency of HAB exposure and that the overall composition of DRB variants differs between dolphin survivors and non-survivors of H ABs.
Abstract: The role the major histocompatibility complex (MHC) plays in response to exposure to environmental toxins is relatively poorly understood, particularly in comparison to its well-described role in pathogen immunity. We investigated associations between MHC diversity and resistance to brevetoxins in common bottlenose dolphins (Tursiops truncatus). A previous genome-wide association study investigating an apparent difference in harmful algal bloom (HAB) resistance among dolphin populations in the Gulf of Mexico identified genetic variation associated with survival in close genomic proximity to multiple MHC class II loci. Here, we characterized genetic variation at DQA, DQB, DRA, and DRB loci in dolphins from central-west Florida and the Florida Panhandle, including dolphins that died during HABs and dolphins presumed to have survived HAB exposure. We found that DRB and DQB exhibited patterns of genetic differentiation among geographic regions that differed from neutral microsatellite loci. In addition, genetic differentiation at DRB across multiple pairwise comparisons of live and dead dolphins was greater than differentiation observed at neutral loci. Our findings at these MHC loci did not approach the strength of association with survival previously described for a nearby genetic variant. However, the results provide evidence that selective pressures at the MHC vary among dolphin populations that differ in the frequency of HAB exposure and that the overall composition of DRB variants differs between dolphin survivors and non-survivors of HABs. These results may suggest a potential role of MHC diversity in variable survival of bottlenose dolphins exposed to HABs.
TL;DR: The results suggest that the gene duplication event leading to these two loci in Leach’s storm-petrel is not recent and that point mutations and positive selection on the peptide binding sites may be the predominant forces acting on these genes.
Abstract: The major histocompatibility complex (Mhc) is subject to pathogen-mediated balancing selection and can link natural selection with mate choice. We characterized two Mhc class II B loci in Leach’s storm-petrel, Oceanodroma leucorhoa, focusing on exon 2 which encodes the portion of the protein that binds pathogen peptides. We amplified and sequenced exon 2 with locus-specific nested PCR and Illumina MiSeq using individually barcoded primers. Repeat genotyping of 78 single-locus genotypes produced identical results in 77 cases (98.7 %). Sequencing of messenger RNA (mRNA) from three birds confirmed expression of both loci, consistent with the observed absence of stop codons or frameshifts in all alleles. In 48 birds, we found 9 and 12 alleles at the two loci, respectively, and all 21 alleles translated to unique amino acid sequences. Unlike many studies of duplicated Mhc genes, alleles of the two loci clustered into monophyletic groups. Consistent with this phylogenetic result, interlocus gene conversion appears to have affected only two short fragments of the exon. As predicted under a paradigm of pathogen-mediated selection, comparison of synonymous and non-synonymous substitution rates found evidence of a history of positive selection at putative peptide binding sites. Overall, the results suggest that the gene duplication event leading to these two loci is not recent and that point mutations and positive selection on the peptide binding sites may be the predominant forces acting on these genes. Characterization of these loci sets the stage for population-level work on the evolutionary ecology of Mhc in this species.
TL;DR: The results support the presence of overlapping loci between RA and T1D in Pakistani patients.
Abstract: Rheumatoid arthritis (RA) and type 1 diabetes (T1D) are two autoimmune disorders that have been reported to co-occur in the same subjects or in different subjects from the same family. This suggests the sharing of disease susceptibility loci between RA and T1D. This study was aimed to find out such susceptibility loci that are common in both T1D and RA in Pakistani population. A total of 366 Pakistanis comprising related and unrelated RA cases and controls were recruited. Blood samples were collected from all patients followed by DNA isolation. Thirty-one single-nucleotide polymorphisms (SNPs) previously reported to be associated with T1D were genotyped in RA cases and controls using TaqMan SNP genotyping assays. Data was analyzed using FamCC software. We have identified seven SNP associations that survived multiple testing corrections using false discovery rate: SKAP2/rs7804356 (p = 2.47E-04), GLIS3/rs7020673 (p = 2.86E-04), GSDMB/rs2290400 (p = 23.48E-04), BACH2/rs11755527 (p = 9.16E-04), C6orf173/ rs9388489 (p = 3.11E-03), PRKCQ/DKFZp667F0711/ rs947474 (p = 4.53E-03), and DLK1/ rs941576 (p = 9.51E-03). Our results support the presence of overlapping loci between RA and T1D in Pakistani patients.
TL;DR: This study used Roche/454 and Illumina MiSeq deep sequencing to determine the MHC class I transcripts in a cohort of 165 sooty mangabeys from the Yerkes National Primate Research Center and identified 121 functionally full-length classical and non-classical alleles and 22 Ceat-A/Ceat-B haplotype chromosomal combinations.
Abstract: Sooty mangabeys (Cercocebus atys) are natural SIV hosts and the presumed source of HIV-2 and SIVmac, which makes them a valuable model for HIV/SIV research. However, like other African primates, little is known about their major histocompatibility complex (MHC) genetics. In this study, we used Roche/454 and Illumina MiSeq deep sequencing in order to determine the MHC class I transcripts in a cohort of 165 sooty mangabeys from the Yerkes National Primate Research Center (YNPRC). We have characterized 121 functionally full-length classical (Ceat-A and Ceat-B) and non-classical (Ceat-F and Ceat-I) alleles and have also identified 22 Ceat-A/Ceat-B haplotype chromosomal combinations. We correlated these Ceat-A/Ceat-B haplotype combinations to recently described microsatellite haplotypes from the YNPRC colony. These newly identified alleles and haplotypes establish a resource for studying cellular immunity in sooty mangabeys and provide a framework for rapidly cataloging MHC class I sequences in an understudied, yet important, nonhuman primate species.