Showing papers in "Molecular and Cellular Biology in 2016"
••
TL;DR: Taking the data collectively, AMPK phosphorylates Nrf2 at the Ser550 residue, which, in conjunction with AMPK-mediated GSK3β inhibition, promotes nuclear accumulation of NRF2 for antioxidant response element (ARE)-driven gene transactivation.
Abstract: Nrf2 (nuclear factor erythroid 2-related factor 2) is an antioxidant transcription factor. AMP-activated protein kinase (AMPK) functions as a central regulator of cell survival in response to stressful stimuli. Nrf2 should be coordinated with the cell survival pathway controlled by AMPK, but so far the mechanistic connections remain undefined. This study investigated the role of AMPK in Nrf2 trafficking and its activity regulation. A subnetwork integrating neighbor molecules suggested direct interaction between AMPK and Nrf2. In cells, AMPK activation caused nuclear accumulation of Nrf2. In the in vitro kinase and peptide competition assays, AMPK phosphorylated Nrf2 at the Ser558 residue (Ser550 in mouse) located in the canonical nuclear export signal. Nrf2 with an S550A mutation failed to be accumulated in the nucleus after AMPK activation. Leptomycin B, a nuclear export inhibitor, did not enhance nuclear accumulation of wild-type Nrf2 (WT-Nrf2) activated by AMPK or a phospho-Ser550-mimetic Nrf2 mutant, corroborating the finding that AMPK facilitated nuclear accumulation of Nrf2, probably by inhibiting nuclear export. Activated glycogen synthase kinase 3β (GSK3β) diminished the basal nuclear level of Myc-S550A-Nrf2. Taking the data collectively, AMPK phosphorylates Nrf2 at the Ser550 residue, which, in conjunction with AMPK-mediated GSK3β inhibition, promotes nuclear accumulation of Nrf2 for antioxidant response element (ARE)-driven gene transactivation.
317 citations
••
TL;DR: Overall, for the first time, in vivo evidence of the role of AMPK in the phosphorylation and regulation of desnutrin/ATGL and HSL and thus adipose lipolysis is provided.
Abstract: The role of AMP-activated protein kinase (AMPK) in promoting fatty acid (FA) oxidation in various tissues, such as liver and muscle, has been well understood. However, the role of AMPK in lipolysis and FA metabolism in adipose tissue has been controversial. To investigate the role of AMPK in the regulation of adipose lipolysis in vivo, we generated mice with adipose-tissue-specific knockout of both the α1 and α2 catalytic subunits of AMPK (AMPK-ASKO mice) by using aP2-Cre and adiponectin-Cre. Both models of AMPK-ASKO ablation show no changes in desnutrin/ATGL levels but have defective phosphorylation of desnutrin/ATGL at S406 to decrease its triacylglycerol (TAG) hydrolase activity, lowering basal lipolysis in adipose tissue. These mice also show defective phosphorylation of hormone-sensitive lipase (HSL) at S565, with higher phosphorylation at protein kinase A sites S563 and S660, increasing its hydrolase activity and isoproterenol-stimulated lipolysis. With higher overall adipose lipolysis, both models of AMPK-ASKO mice are lean, having smaller adipocytes with lower TAG and higher intracellular free-FA levels. Moreover, FAs from higher lipolysis activate peroxisome proliferator-activated receptor delta to induce FA oxidative genes and increase FA oxidation and energy expenditure. Overall, for the first time, we provide in vivo evidence of the role of AMPK in the phosphorylation and regulation of desnutrin/ATGL and HSL and thus adipose lipolysis.
193 citations
••
TL;DR: The reason why spike- in controls are so important is described and how to appropriately design and use spike-in controls for normalization is explained and ways to retrospectively renormalize data sets that were wrongly interpreted due to omission of spike-In controls are suggested.
Abstract: Genome-wide analyses of changes in gene expression, transcription factor occupancy on DNA, histone modification patterns on chromatin, genomic copy number variation, and nucleosome positioning have become popular in many modern laboratories, yielding a wealth of information during health and disease states. However, most of these studies have overlooked an inherent normalization problem that must be corrected with spike-in controls. Here we describe the reason why spike-in controls are so important and explain how to appropriately design and use spike-in controls for normalization. We also suggest ways to retrospectively renormalize data sets that were wrongly interpreted due to omission of spike-in controls.
155 citations
••
TL;DR: It is shown that SIRT3 controls transformation of fibroblasts into myofibroblast via suppressing the profibrotic TGF-β1 signaling, and discloses a novel phosphorylation-independent mechanism controlling the catalytic activity of GSK3β.
Abstract: Tissue fibrosis is a major cause of organ dysfunction during chronic diseases and aging. A critical step in this process is transforming growth factor β1 (TGF-β1)-mediated transformation of fibroblasts into myofibroblasts, cells capable of synthesizing extracellular matrix. Here, we show that SIRT3 controls transformation of fibroblasts into myofibroblasts via suppressing the profibrotic TGF-β1 signaling. We found that Sirt3 knockout (KO) mice with age develop tissue fibrosis of multiple organs, including heart, liver, kidney, and lungs but not whole-body SIRT3-overexpressing mice. SIRT3 deficiency caused induction of TGF-β1 expression and hyperacetylation of glycogen synthase kinase 3β (GSK3β) at residue K15, which negatively regulated GSK3β activity to phosphorylate the substrates Smad3 and β-catenin. Reduced phosphorylation led to stabilization and activation of these transcription factors regulating expression of the profibrotic genes. SIRT3 deacetylated and activated GSK3β and thereby blocked TGF-β1 signaling and tissue fibrosis. These data reveal a new role of SIRT3 to negatively regulate aging-associated tissue fibrosis and discloses a novel phosphorylation-independent mechanism controlling the catalytic activity of GSK3β.
141 citations
••
TL;DR: The broad role of posttranscriptional regulation during the EMT is highlighted and the important role of combinatorial regulation by different splicing factors to fine tune gene expression programs during these physiological and developmental transitions is highlighted.
Abstract: The epithelial-to-mesenchymal transition (EMT) is an essential biological process during embryonic development that is also implicated in cancer metastasis. While the transcriptional regulation of EMT has been well studied, the role of alternative splicing (AS) regulation in EMT remains relatively uncharacterized. We previously showed that the epithelial cell-type-specific proteins epithelial splicing regulatory proteins 1 (ESRP1) and ESRP2 are important for the regulation of many AS events that are altered during EMT. However, the contributions of the ESRPs and other splicing regulators to the AS regulatory network in EMT require further investigation. Here, we used a robust in vitro EMT model to comprehensively characterize splicing switches during EMT in a temporal manner. These investigations revealed that the ESRPs are the major regulators of some but not all AS events during EMT. We determined that the splicing factor RBM47 is downregulated during EMT and also regulates numerous transcripts that switch splicing during EMT. We also determined that Quaking (QKI) broadly promotes mesenchymal splicing patterns. Our study highlights the broad role of posttranscriptional regulation during the EMT and the important role of combinatorial regulation by different splicing factors to fine tune gene expression programs during these physiological and developmental transitions.
117 citations
••
TL;DR: The data indicate that the RNA-unwinding protein DEAD box 1 (DDX1) is required for efficient DSB repair and cell survival after ionizing radiation (IR), with depletion of DDX1 resulting in reduced D SB repair by homologous recombination (HR).
Abstract: Although RNA and RNA-binding proteins have been linked to double-strand breaks (DSBs), little is known regarding their roles in the cellular response to DSBs and, if any, in the repair process. Here, we provide direct evidence for the presence of RNA-DNA hybrids at DSBs and suggest that binding of RNA to DNA at DSBs may impact repair efficiency. Our data indicate that the RNA-unwinding protein DEAD box 1 (DDX1) is required for efficient DSB repair and cell survival after ionizing radiation (IR), with depletion of DDX1 resulting in reduced DSB repair by homologous recombination (HR). While DDX1 is not essential for end resection, a key step in homology-directed DSB repair, DDX1 is required for maintenance of the single-stranded DNA once generated by end resection. We show that transcription deregulation has a significant effect on DSB repair by HR in DDX1-depleted cells and that RNA-DNA duplexes are elevated at DSBs in DDX1-depleted cells. Based on our combined data, we propose a role for DDX1 in resolving RNA-DNA structures that accumulate at DSBs located at sites of active transcription. Our findings point to a previously uncharacterized requirement for clearing RNA at DSBs for efficient repair by HR.
113 citations
••
TL;DR: Results indicate that H19 interacts with HuR and regulates the intestinal epithelial barrier function via the H19-encoded miR-675 by altering ZO-1 and E-cadherin expression posttranscriptionally.
Abstract: The disruption of the intestinal epithelial barrier function occurs commonly in various pathologies, but the exact mechanisms responsible are unclear. The H19 long noncoding RNA (lncRNA) regulates the expression of different genes and has been implicated in human genetic disorders and cancer. Here, we report that H19 plays an important role in controlling the intestinal epithelial barrier function by serving as a precursor for microRNA 675 (miR-675). H19 overexpression increased the cellular abundance of miR-675, which in turn destabilized and repressed the translation of mRNAs encoding tight junction protein ZO-1 and adherens junction E-cadherin, resulting in the dysfunction of the epithelial barrier. Increasing the level of the RNA-binding protein HuR in cells overexpressing H19 prevented the stimulation of miR-675 processing from H19, promoted ZO-1 and E-cadherin expression, and restored the epithelial barrier function to a nearly normal level. In contrast, the targeted deletion of HuR in intestinal epithelial cells enhanced miR-675 production in the mucosa and delayed the recovery of the gut barrier function after exposure to mesenteric ischemia/reperfusion. These results indicate that H19 interacts with HuR and regulates the intestinal epithelial barrier function via the H19-encoded miR-675 by altering ZO-1 and E-cadherin expression posttranscriptionally.
110 citations
••
TL;DR: This review summarizes the presently available data on characterized PTMs of key BER proteins, the functional consequences of these modifications at the protein level, and also the impact on BER in vitro and in vivo.
Abstract: Base excision repair (BER) is an essential DNA repair pathway involved in the maintenance of genome stability and thus in the prevention of human diseases, such as premature aging, neurodegenerative diseases, and cancer. Protein posttranslational modifications (PTMs), including acetylation, methylation, phosphorylation, SUMOylation, and ubiquitylation, have emerged as important contributors in controlling cellular BER protein levels, enzymatic activities, protein-protein interactions, and protein cellular localization. These PTMs therefore play key roles in regulating the BER pathway and are consequently crucial for coordinating an efficient cellular DNA damage response. In this review, we summarize the presently available data on characterized PTMs of key BER proteins, the functional consequences of these modifications at the protein level, and also the impact on BER in vitro and in vivo.
107 citations
••
TL;DR: Investigating the endothelial PHD2/HIF axis in the regulation of vascular function found that inactivation of Phd2 in endothelial cells specifically resulted in severe pulmonary hypertension but not polycythemia and was associated with abnormal muscularization of peripheral pulmonary arteries and right ventricular hypertrophy.
Abstract: Hypoxia-inducible factors 1 and 2 (HIF-1 and -2) control oxygen supply to tissues by regulating erythropoiesis, angiogenesis and vascular homeostasis. HIFs are regulated in response to oxygen availability by prolyl-4-hydroxylase domain (PHD) proteins, with PHD2 being the main oxygen sensor that controls HIF activity under normoxia. In this study, we used a genetic approach to investigate the endothelial PHD2/HIF axis in the regulation of vascular function. We found that inactivation of Phd2 in endothelial cells specifically resulted in severe pulmonary hypertension (∼118% increase in right ventricular systolic pressure) but not polycythemia and was associated with abnormal muscularization of peripheral pulmonary arteries and right ventricular hypertrophy. Concurrent inactivation of either Hif1a or Hif2a in endothelial cell-specific Phd2 mutants demonstrated that the development of pulmonary hypertension was dependent on HIF-2α but not HIF-1α. Furthermore, endothelial HIF-2α was required for the development of increased pulmonary artery pressures in a model of pulmonary hypertension induced by chronic hypoxia. We propose that these HIF-2-dependent effects are partially due to increased expression of vasoconstrictor molecule endothelin 1 and a concomitant decrease in vasodilatory apelin receptor signaling. Taken together, our data identify endothelial HIF-2 as a key transcription factor in the pathogenesis of pulmonary hypertension.
103 citations
••
TL;DR: The results suggest that Atg13 has both autophagic and nonautophagic functions and that the latter are essential for cardiac development and likely shared with FIP200 but not with ULK1/2.
Abstract: Autophagy is a major intracellular degradation system by which cytoplasmic components are enclosed by autophagosomes and delivered to lysosomes. Formation of the autophagosome requires a set of autophagy-related (Atg) proteins. Among these proteins, the ULK1 complex, which is composed of ULK1 (or ULK2), FIP200, Atg13, and Atg101, acts at an initial step. Previous studies showed that ULK1 and FIP200 also function in pathways other than autophagy. However, whether Atg13 and Atg101 act similarly to ULK1 and FIP200 remains unknown. In the present study, we generated Atg13 knockout mice. Like FIP200-deficient mice, Atg13-deficient mice die in utero, which is distinct from most other types of Atg-deficient mice. Atg13-deficient embryos show growth retardation and myocardial growth defects. In cultured fibroblasts, Atg13 deficiency blocks autophagosome formation at an upstream step. In addition, sensitivity to tumor necrosis factor alpha (TNF-α)-induced apoptosis is enhanced by deletion of Atg13 or FIP200, but not by other Atg proteins, as well as by simultaneous deletion of ULK1 and ULK2. These results suggest that Atg13 has both autophagic and nonautophagic functions and that the latter are essential for cardiac development and likely shared with FIP200 but not with ULK1/2.
95 citations
••
TL;DR: It is shown that the water/glycerol channel protein aquaporin-3 (AQP3) is required for CXCL12/CXCR4-dependent breast cancer cell migration through a mechanism involving its hydrogen peroxide (H2O2) transport function and suggested that AQP3 has potential as a therapeutic target for breast cancer.
Abstract: Most breast cancer mortality is due to clinical relapse associated with metastasis. CXCL12/CXCR4-dependent cell migration is a critical process in breast cancer progression; however, its underlying mechanism remains to be elucidated. Here, we show that the water/glycerol channel protein aquaporin-3 (AQP3) is required for CXCL12/CXCR4-dependent breast cancer cell migration through a mechanism involving its hydrogen peroxide (H2O2) transport function. Extracellular H2O2, produced by CXCL12-activated membrane NADPH oxidase 2 (Nox2), was transported into breast cancer cells via AQP3. Transient H2O2 accumulation was observed around the membrane during CXCL12-induced migration, which may be facilitated by the association of AQP3 with Nox2. Intracellular H2O2 then oxidized PTEN and protein tyrosine phosphatase 1B (PTP1B) followed by activation of the Akt pathway. This contributed to directional cell migration. The expression level of AQP3 in breast cancer cells was related to their migration ability both in vitro and in vivo through CXCL12/CXCR4- or H2O2-dependent pathways. Coincidentally, spontaneous metastasis of orthotopic xenografts to the lung was reduced upon AQP3 knockdown. These findings underscore the importance of AQP3-transported H2O2 in CXCL12/CXCR4-dependent signaling and migration in breast cancer cells and suggest that AQP3 has potential as a therapeutic target for breast cancer.
••
TL;DR: The results demonstrate that Nrf2 induction in SkM increases GBE and PhKα expression and reduces muscle glycogen content, resulting in improved glucose tolerance, and indicate that NRF2 differentially regulates glycogen metabolism inSkM and the liver.
Abstract: Nrf2 (NF-E2-related factor 2) contributes to the maintenance of glucose homeostasis in vivo Nrf2 suppresses blood glucose levels by protecting pancreatic β cells from oxidative stress and improving peripheral tissue glucose utilization. To elucidate the molecular mechanisms by which Nrf2 contributes to the maintenance of glucose homeostasis, we generated skeletal muscle (SkM)-specific Keap1 knockout (Keap1MuKO) mice that express abundant Nrf2 in their SkM and then examined Nrf2 target gene expression in that tissue. In Keap1MuKO mice, blood glucose levels were significantly downregulated and the levels of the glycogen branching enzyme (Gbe1) and muscle-type PhKα subunit (Phka1) mRNAs, along with those of the glycogen branching enzyme (GBE) and the phosphorylase b kinase α subunit (PhKα) protein, were significantly upregulated in mouse SkM. Consistent with this result, chemical Nrf2 inducers promoted Gbe1 and Phka1 mRNA expression in both mouse SkM and C2C12 myotubes. Chromatin immunoprecipitation analysis demonstrated that Nrf2 binds the Gbe1 and Phka1 upstream promoter regions. In Keap1MuKO mice, muscle glycogen content was strongly reduced and forced GBE expression in C2C12 myotubes promoted glucose uptake. Therefore, our results demonstrate that Nrf2 induction in SkM increases GBE and PhKα expression and reduces muscle glycogen content, resulting in improved glucose tolerance. Our results also indicate that Nrf2 differentially regulates glycogen metabolism in SkM and the liver.
••
TL;DR: It is suggested that a miR-200, ZEB1, GRHL2 gene regulatory network may drive sarcoma cells to a more epithelial-like state and that this likely has prognostic relevance.
Abstract: Phenotypic plasticity involves a process in which cells transiently acquire phenotypic traits of another lineage. Two commonly studied types of phenotypic plasticity are epithelial-mesenchymal transition (EMT) and mesenchymal-epithelial transition (MET). In carcinomas, EMT drives invasion and metastatic dissemination, while MET is proposed to play a role in metastatic colonization. Phenotypic plasticity in sarcomas is not well studied; however, there is evidence that a subset of sarcomas undergo an MET-like phenomenon. While the exact mechanisms by which these transitions occur remain largely unknown, it is likely that some of the same master regulators that drive EMT and MET in carcinomas also act in sarcomas. In this study, we combined mathematical models with bench experiments to identify a core regulatory circuit that controls MET in sarcomas. This circuit comprises the microRNA 200 (miR-200) family, ZEB1, and GRHL2. Interestingly, combined expression of miR-200s and GRHL2 further upregulates epithelial genes to induce MET. This effect is phenocopied by downregulation of either ZEB1 or the ZEB1 cofactor, BRG1. In addition, an MET gene expression signature is prognostic for improved overall survival in sarcoma patients. Together, our results suggest that a miR-200, ZEB1, GRHL2 gene regulatory network may drive sarcoma cells to a more epithelial-like state and that this likely has prognostic relevance.
••
TL;DR: This work built a comprehensive catalog of lncRNAs by combining known l NCRNAs with high-confidence novel lnc RNAs identified by mapping and de novo assembling billions of RNA-seq reads from eight tissues and a primary cell line in mouse and found two different classes of chromatin state-associated lNCRNAs across various tissues.
Abstract: Discovering and classifying long noncoding RNAs (lncRNAs) across all mammalian tissues and cell lines remains a major challenge. Previously, mouse lncRNAs were identified using transcriptome sequencing (RNA-seq) data from a limited number of tissues or cell lines. Additionally, associating a few hundred lncRNA promoters with chromatin states in a single mouse cell line has identified two classes of chromatin-associated lncRNA. However, the discovery and classification of lncRNAs is still pending in many other tissues in mouse. To address this, we built a comprehensive catalog of lncRNAs by combining known lncRNAs with high-confidence novel lncRNAs identified by mapping and de novo assembling billions of RNA-seq reads from eight tissues and a primary cell line in mouse. Next, we integrated this catalog of lncRNAs with multiple genome-wide chromatin state maps and found two different classes of chromatin state-associated lncRNAs, including promoter-associated (plncRNAs) and enhancer-associated (elncRNAs) lncRNAs, across various tissues. Experimental knockdown of an elncRNA resulted in the downregulation of the neighboring protein-coding Kdm8 gene, encoding a histone demethylase. Our findings provide 2,803 novel lncRNAs and a comprehensive catalog of chromatin-associated lncRNAs across different tissues in mouse.
••
TL;DR: These findings identify C/EBPγ as a novel antioxidant regulator and an obligatory ATF4 partner that controls redox homeostasis in normal and cancerous cells.
Abstract: The integrated stress response (ISR) controls cellular adaptations to nutrient deprivation, redox imbalances, and endoplasmic reticulum (ER) stress. ISR genes are upregulated in stressed cells, primarily by the bZIP transcription factor ATF4 through its recruitment to cis-regulatory C/EBP:ATF response elements (CAREs) together with a dimeric partner of uncertain identity. Here, we show that C/EBPγ:ATF4 heterodimers, but not C/EBPβ:ATF4 dimers, are the predominant CARE-binding species in stressed cells. C/EBPγ and ATF4 associate with genomic CAREs in a mutually dependent manner and coregulate many ISR genes. In contrast, the C/EBP family members C/EBPβ and C/EBP homologous protein (CHOP) were largely dispensable for induction of stress genes. Cebpg(-/-) mouse embryonic fibroblasts (MEFs) proliferate poorly and exhibit oxidative stress due to reduced glutathione levels and impaired expression of several glutathione biosynthesis pathway genes. Cebpg(-/-) mice (C57BL/6 background) display reduced body size and microphthalmia, similar to ATF4-null animals. In addition, C/EBPγ-deficient newborns die from atelectasis and respiratory failure, which can be mitigated by in utero exposure to the antioxidant, N-acetyl-cysteine. Cebpg(-/-) mice on a mixed strain background showed improved viability but, upon aging, developed significantly fewer malignant solid tumors than WT animals. Our findings identify C/EBPγ as a novel antioxidant regulator and an obligatory ATF4 partner that controls redox homeostasis in normal and cancerous cells.
••
TL;DR: It is demonstrated that the regulation of the Nrf2 protein level during stress responses is mediated by the activity but not the composition of theNrf2-Keap1-Cul3 complex.
Abstract: The transcription factor Nrf2 (NF-E2-related-factor 2) is essential for the oxidative and electrophilic stress responses. Keap1 (Kelch-like-ECH-associated-protein 1), an adaptor for a cullin-3 (Cul3)-based ubiquitin ligase, regulates Nrf2 activity through proteasomal degradation, and acts as a sensor for oxidative and electrophilic stresses. The Keap1-Cul3 complex is a critical regulator of the cellular Nrf2 level, and yet quantitative information regarding their endogenous intracellular concentrations in homeostatic conditions and during stress responses is unknown. We analyzed the absolute amounts of the Nrf2, Keap1, and Cul3 proteins in five murine cell lines by comparison with serial dilutions of purified recombinant protein standards in combination with quantitative immunoblot analyses. In the basal state, the amount of Nrf2 was maintained at lower levels than those of Keap1 and Cul3 proteins, whereas the electrophilic agent diethylmaleate dramatically increased Nrf2 to a level greater than that of Keap1 and Cul3, resulting in the accumulation of Nrf2 in the nucleus. In contrast, Keap1 and Cul3 did not display any changes in their abundance, subcellular localization, or interaction in response to electrophilic stimuli. Our results demonstrate that the regulation of the Nrf2 protein level during stress responses is mediated by the activity but not the composition of the Nrf2-Keap1-Cul3 complex.
••
TL;DR: Results showed that PTF1A maintains the expression of genes for all cellular processes dedicated to the production of the secretory digestive enzymes, a highly attuned surveillance of unfolded proteins, and a heightened unfolded protein response (UPR).
Abstract: Maintenance of cell type identity is crucial for health, yet little is known of the regulation that sustains the long-term stability of differentiated phenotypes. To investigate the roles that key transcriptional regulators play in adult differentiated cells, we examined the effects of depletion of the developmental master regulator PTF1A on the specialized phenotype of the adult pancreatic acinar cell in vivo Transcriptome sequencing and chromatin immunoprecipitation sequencing results showed that PTF1A maintains the expression of genes for all cellular processes dedicated to the production of the secretory digestive enzymes, a highly attuned surveillance of unfolded proteins, and a heightened unfolded protein response (UPR). Control by PTF1A is direct on target genes and indirect through a ten-member transcription factor network. Depletion of PTF1A causes an imbalance that overwhelms the UPR, induces cellular injury, and provokes acinar metaplasia. Compromised cellular identity occurs by derepression of characteristic stomach genes, some of which are also associated with pancreatic ductal cells. The loss of acinar cell homeostasis, differentiation, and identity is directly relevant to the pathologies of pancreatitis and pancreatic adenocarcinoma.
••
TL;DR: The hypothesis that miR-211 loss in melanoma cells causes abnormal regulation of energy metabolism, which in turn allows cancer cells to survive under low oxygen concentrations—a condition that generally kills normal cells is supported.
Abstract: MicroRNA 211 (miR-211) negatively regulates genes that drive invasion of metastatic melanoma. Compared to normal human melanocytes, miR-211 expression is significantly reduced or absent in nonpigmented melanoma cells and lost during human melanoma progression. To investigate the molecular mechanism of its tumor suppressor function, miR-211 was ectopically expressed in nonpigmented melanoma cells. Ectopic expression of miR-211 reduced hypoxia-inducible factor 1α (HIF-1α) protein levels and decreased cell growth during hypoxia. HIF-1α protein loss was correlated with the downregulation of a miR-211 target gene, pyruvate dehydrogenase kinase 4 (PDK4). We present evidence that resumption of miR-211-mediated downregulation of PDK4 in melanoma cells causes inhibition of invasion by nonpigmented melanomas via HIF-1α protein destabilization. Thus, the tumor suppressor miR-211 acts as a metabolic switch, and its loss is expected to promote cancer hallmarks in human melanomas. Melanoma, one of the deadliest forms of skin cancer, kills nearly 10,000 people in the United States per year. We had previously shown that a small noncoding RNA, termed miR-211, suppresses invasion and the growth of aggressive melanoma cells. The results presented here support the hypothesis that miR-211 loss in melanoma cells causes abnormal regulation of energy metabolism, which in turn allows cancer cells to survive under low oxygen concentrations-a condition that generally kills normal cells. These findings highlight a novel mechanism of melanoma formation: miR-211 is a molecular switch that is turned off in melanoma cells, raising the hope that in the future we might be able to turn the switch back on, thus providing a better treatment option for melanoma.
••
TL;DR: It is shown that the dietary agent phenethyl isothiocyanate inhibits heat shock protein 90 (Hsp90), the main negative regulator of HSF1; activates p38 mitogen-activated protein kinase (MAPK); and increases S326 phosphorylation, trimerization, and nuclear translocation of HSf1, and the transcription of a luciferase reporter, as well as the endogenous prototypic HSF 1 target Hsp70.
Abstract: Heat shock factor 1 (HSF1) monitors the structural integrity of the proteome. Phosphorylation at S326 is a hallmark for HSF1 activation, but the identity of the kinase(s) phosphorylating this site has remained elusive. We show here that the dietary agent phenethyl isothiocyanate (PEITC) inhibits heat shock protein 90 (Hsp90), the main negative regulator of HSF1; activates p38 mitogen-activated protein kinase (MAPK); and increases S326 phosphorylation, trimerization, and nuclear translocation of HSF1, and the transcription of a luciferase reporter, as well as the endogenous prototypic HSF1 target Hsp70. In vitro, all members of the p38 MAPK family rapidly and stoichiometrically catalyze the S326 phosphorylation. The use of stable knockdown cell lines and inhibitors indicated that among the p38 MAPKs, p38γ is the principal isoform responsible for the phosphorylation of HSF1 at S326 in cells. A protease-mass spectrometry approach confirmed S326 phosphorylation and unexpectedly revealed that p38 MAPK also catalyzes the phosphorylation of HSF1 at S303/307, previously known repressive posttranslational modifications. Thus, we have identified p38 MAPKs as highly efficient catalysts for the phosphorylation of HSF1. Furthermore, our findings suggest that the magnitude and persistence of activation of p38 MAPK are important determinants of the extent and duration of the heat shock response.
••
TL;DR: The results suggest that TMEM16E may function as a phospholipid scramblase at inner membranes and that its defect affects sperm motility.
Abstract: Transmembrane protein 16E (TMEM16E) belongs to the TMEM16 family of proteins that have 10 transmembrane regions and appears to localize intracellularly. Although TMEM16E mutations cause bone fragility and muscular dystrophy in humans, its biochemical function is unknown. In the TMEM16 family, TMEM16A and -16B serve as Ca(2+)-dependent Cl(-) channels, while TMEM16C, -16D, -16F, -16G, and -16J support Ca(2+)-dependent phospholipid scrambling. Here, we show that TMEM16E carries a segment composed of 35 amino acids homologous to the scrambling domain in TMEM16F. When the corresponding segment of TMEM16A was replaced by this 35-amino-acid segment of TMEM16E, the chimeric molecule localized to the plasma membrane and supported Ca(2+)-dependent scrambling. We next established TMEM16E-deficient mice, which appeared to have normal skeletal muscle. However, fertility was decreased in the males. We found that TMEM16E was expressed in germ cells in early spermatogenesis and thereafter and localized to sperm tail. TMEM16E(-/-) sperm showed no apparent defect in morphology, beating, mitochondrial function, capacitation, or binding to zona pellucida. However, they showed reduced motility and inefficient fertilization of cumulus-free but zona-intact eggs in vitro. Our results suggest that TMEM16E may function as a phospholipid scramblase at inner membranes and that its defect affects sperm motility.
••
TL;DR: The recent findings on human Deubiquitinating enzymes that participate in genome maintenance are discussed, with a focus on the role of DUBs in the modulation of DNA repair and DNA damage signaling.
Abstract: Both proteolytic and nonproteolytic functions of ubiquitination are essential regulatory mechanisms for promoting DNA repair and the DNA damage response in mammalian cells. Deubiquitinating enzymes (DUBs) have emerged as key players in the maintenance of genome stability. In this minireview, we discuss the recent findings on human DUBs that participate in genome maintenance, with a focus on the role of DUBs in the modulation of DNA repair and DNA damage signaling.
••
TL;DR: The KEAP1-NRF2-MED16 axis has emerged as a new regulatory pathway mediating the antioxidant response through the robust activation of NRF2 target genes in cytoprotection and turned out to be essential for cy toprotection against oxidative insults.
Abstract: The KEAP1-NRF2 system plays a central role in cytoprotection. NRF2 is stabilized in response to electrophiles and activates transcription of antioxidant genes. Although robust induction of NRF2 target genes confers resistance to oxidative insults, how NRF2 triggers transcriptional activation after binding to DNA has not been elucidated. To decipher the molecular mechanisms underlying NRF2-dependent transcriptional activation, we purified the NRF2 nuclear protein complex and identified the Mediator subunits as NRF2 cofactors. Among them, MED16 directly associated with NRF2. Disruption of Med16 significantly attenuated the electrophile-induced expression of NRF2 target genes but did not affect hypoxia-induced gene expression, suggesting a specific requirement for MED16 in NRF2-dependent transcription. Importantly, we found that 75% of NRF2-activated genes exhibited blunted inductions by electrophiles in Med16-deficient cells compared to wild-type cells, which strongly argues that MED16 is a major contributor supporting NRF2-dependent transcriptional activation. NRF2-dependent phosphorylation of the RNA polymerase II C-terminal domain was absent in Med16-deficient cells, suggesting that MED16 serves as a conduit to transmit NRF2-activating signals to RNA polymerase II. MED16 indeed turned out to be essential for cytoprotection against oxidative insults. Thus, the KEAP1-NRF2-MED16 axis has emerged as a new regulatory pathway mediating the antioxidant response through the robust activation of NRF2 target genes.
••
TL;DR: Evidence is provided that yeast Mediator is not monolithic but potentially has a dynamic complexity heretofore unappreciated and that core Mediator has a role in regulating postinitiation events.
Abstract: Mediator is an evolutionarily conserved coactivator complex essential for RNA polymerase II transcription Although it has been generally assumed that in Saccharomyces cerevisiae, Mediator is a stable trimodular complex, its structural state in vivo remains unclear Using the "anchor away" (AA) technique to conditionally deplete select subunits within Mediator and its reversibly associated Cdk8 kinase module (CKM), we provide evidence that Mediator's tail module is highly dynamic and that a subcomplex consisting of Med2, Med3, and Med15 can be independently recruited to the regulatory regions of heat shock factor 1 (Hsf1)-activated genes Fluorescence microscopy of a scaffold subunit (Med14)-anchored strain confirmed parallel cytoplasmic sequestration of core subunits located outside the tail triad In addition, and contrary to current models, we provide evidence that Hsf1 can recruit the CKM independently of core Mediator and that core Mediator has a role in regulating postinitiation events Collectively, our results suggest that yeast Mediator is not monolithic but potentially has a dynamic complexity heretofore unappreciated Multiple species, including CKM-Mediator, the 21-subunit core complex, the Med2-Med3-Med15 tail triad, and the four-subunit CKM, can be independently recruited by activated Hsf1 to its target genes in AA strains
••
TL;DR: This minireview summarizes the identification and analysis of the KAT6 complexes and discusses the regulatory mechanisms governing their enzymatic activities and substrate specificities and focuses on the roles of Kat6 HATs in regulating cell proliferation and stem cell maintenance.
Abstract: The lysine acetyltransferase 6 (KAT6) histone acetyltransferase (HAT) complexes are highly conserved from yeast to higher organisms. They acetylate histone H3 and other nonhistone substrates and are involved in cell cycle regulation and stem cell maintenance. In addition, the human KAT6 HATs are recurrently mutated in leukemia and solid tumors. Therefore, it is important to understand the mechanisms underlying the regulation of KAT6 HATs and their roles in cell cycle progression. In this minireview, we summarize the identification and analysis of the KAT6 complexes and discuss the regulatory mechanisms governing their enzymatic activities and substrate specificities. We further focus on the roles of KAT6 HATs in regulating cell proliferation and stem cell maintenance and review recent insights that aid in understanding their involvement in human diseases.
••
TL;DR: The findings show that adipocyte HIF2α is protective against maladaptation to obesity and metabolic dysregulation by promoting angiogenesis in both WAT and BAT and by counteracting obesity-mediated BAT dysfunction.
Abstract: Angiogenesis is a central regulator for white (WAT) and brown (BAT) adipose tissue adaptation in the course of obesity. Here we show that deletion of hypoxia-inducible factor 2α (HIF2α) in adipocytes (by using Fabp4-Cre transgenic mice) but not in myeloid or endothelial cells negatively impacted WAT angiogenesis and promoted WAT inflammation, WAT dysfunction, hepatosteatosis, and systemic insulin resistance in obesity. Importantly, adipocyte HIF2α regulated vascular endothelial growth factor (VEGF) expression and angiogenesis of obese BAT as well as its thermogenic function. Consistently, obese adipocyte-specific HIF2α-deficient mice displayed BAT dysregulation, associated with reduced levels of uncoupling protein 1 (UCP1) and a dysfunctional thermogenic response to cold exposure. VEGF administration reversed WAT and BAT inflammation and BAT dysfunction in adipocyte HIF2α-deficient mice. Together, our findings show that adipocyte HIF2α is protective against maladaptation to obesity and metabolic dysregulation by promoting angiogenesis in both WAT and BAT and by counteracting obesity-mediated BAT dysfunction.
••
TL;DR: The results show that ICL repair and replication termination both utilize a similar mechanism to displace the CMG helicase complex from chromatin, but that distinct regulatory signals ultimately control when and where unloading takes place.
Abstract: Interstrand cross-links (ICLs) are extremely toxic DNA lesions that create an impassable roadblock to DNA replication. When a replication fork collides with an ICL, it triggers a damage response that promotes multiple DNA processing events required to excise the cross-link from chromatin and resolve the stalled replication fork. One of the first steps in this process involves displacement of the CMG replicative helicase (comprised of Cdc45, MCM2-7, and GINS), which obstructs the underlying cross-link. Here we report that the p97/Cdc48/VCP segregase plays a critical role in ICL repair by unloading the CMG complex from chromatin. Eviction of the stalled helicase involves K48-linked polyubiquitylation of MCM7, p97-mediated extraction of CMG, and a largely degradation-independent mechanism of MCM7 deubiquitylation. Our results show that ICL repair and replication termination both utilize a similar mechanism to displace the CMG complex from chromatin. However, unlike termination, repair-mediated helicase unloading involves the tumor suppressor protein BRCA1, which acts upstream of MCM7 ubiquitylation and p97 recruitment. Together, these findings indicate that p97 plays a conserved role in dismantling the CMG helicase complex during different cellular events, but that distinct regulatory signals ultimately control when and where unloading takes place.
••
TL;DR: IL-10 effects to attenuate obesity-mediated inflammation and improve insulin sensitivity in skeletal muscle are demonstrated and implicate a potential therapeutic role of anti-inflammatory cytokines in treating insulin resistance and type 2 diabetes.
Abstract: Skeletal muscle insulin resistance is a major characteristic of obesity and type 2 diabetes. Although obesity-mediated inflammation is causally associated with insulin resistance, the underlying mechanism is unclear. Here, we examined the effects of chronic obesity in mice with muscle-specific overexpression of interleukin-10 (MIL10). After 16 weeks of a high-fat diet (HFD), MIL10 mice became markedly obese but showed improved insulin action compared to that of wild-type mice, which was largely due to increased glucose metabolism and reduced inflammation in skeletal muscle. Since leptin regulates inflammation, the beneficial effects of interleukin-10 (IL-10) were further examined in leptin-deficient ob/ob mice. Muscle-specific overexpression of IL-10 in ob/ob mice (MCK-IL10ob/ob) did not affect spontaneous obesity, but MCK-IL10ob/ob mice showed increased glucose turnover compared to that in ob/ob mice. Last, mice with muscle-specific ablation of IL-10 receptor (M-IL10R-/-) were generated to determine whether IL-10 signaling in skeletal muscle is involved in IL-10 effects on glucose metabolism. After an HFD, M-IL10R-/- mice developed insulin resistance with reduced glucose metabolism compared to that in wild-type mice. Overall, these results demonstrate IL-10 effects to attenuate obesity-mediated inflammation and improve insulin sensitivity in skeletal muscle, and our findings implicate a potential therapeutic role of anti-inflammatory cytokines in treating insulin resistance and type 2 diabetes.
••
TL;DR: The study shows that K-Ras is a target of a metabolic stress-signaling pathway that can be leveraged to inhibit oncogenic K- Ras function.
Abstract: K-Ras must localize to the plasma membrane and be arrayed in nanoclusters for biological activity. We show here that K-Ras is a substrate for cyclic GMP-dependent protein kinases (PKGs). In intact cells, activated PKG2 selectively colocalizes with K-Ras on the plasma membrane and phosphorylates K-Ras at Ser181 in the C-terminal polybasic domain. K-Ras phosphorylation by PKG2 is triggered by activation of AMP-activated protein kinase (AMPK) and requires endothelial nitric oxide synthase and soluble guanylyl cyclase. Phosphorylated K-Ras reorganizes into distinct nanoclusters that retune the signal output. Phosphorylation acutely enhances K-Ras plasma membrane affinity, but phosphorylated K-Ras is progressively lost from the plasma membrane via endocytic recycling. Concordantly, chronic pharmacological activation of AMPK → PKG2 signaling with mitochondrial inhibitors, nitric oxide, or sildenafil inhibits proliferation of K-Ras-positive non-small cell lung cancer cells. The study shows that K-Ras is a target of a metabolic stress-signaling pathway that can be leveraged to inhibit oncogenic K-Ras function.
••
TL;DR: A novel mechanism of MTPα regulation by acetylation and ubiquitylation is revealed and a direct functional link of this regulation to NAFLD is revealed.
Abstract: Nonalcoholic fatty liver disease (NAFLD) has become the most common liver disease, and decreased fatty acid oxidation is one of the important contributors to NAFLD. Mitochondrial trifunctional protein α-subunit (MTPα) functions as a critical enzyme for fatty acid β-oxidation, but whether dysregulation of MTPα is pathogenically connected to NAFLD is poorly understood. We show that MTPα is acetylated at lysine residues 350, 383, and 406 (MTPα-3K), which promotes its protein stability by antagonizing its ubiquitylation on the same three lysines (MTPα-3K) and blocking its subsequent degradation. Sirtuin 4 (SIRT4) has been identified as the deacetylase, deacetylating and destabilizing MTPα. Replacement of MTPα-3K with either MTPα-3KR or MTPα-3KQ inhibits cellular lipid accumulation both in free fatty acid (FFA)-treated alpha mouse liver 12 (AML12) cells and primary hepatocytes and in the livers of high-fat/high-sucrose (HF/HS) diet-fed mice. Moreover, knockdown of SIRT4 could phenocopy the effects of MTPα-3K mutant expression in mouse livers, and MTPα-3K mutants more efficiently attenuate SIRT4-mediated hepatic steatosis in HF/HS diet-fed mice. Importantly, acetylation of both MTPα and MTPα-3K is decreased while SIRT4 is increased in the livers of mice and humans with NAFLD. Our study reveals a novel mechanism of MTPα regulation by acetylation and ubiquitylation and a direct functional link of this regulation to NAFLD.
••
TL;DR: These results identify RASA1 and SPRED1 mRNAs as latent RAS-ERK pathway suppressors that can be upregulated in tumor cells by anti-miR treatment and conclude that KLF4-regulated miRs are important for the maintenance of Ras- ERK pathway activity in TNBC cells.
Abstract: The present invention provides a method for inhibiting the RAS-ERK pathway by upregulation of RASA1 and SPRED1 mRNAs in tumor cells by anti-miR treatment. The method includes wherein an anti-miR-206 binds to a nucleotide comprising the sequence UAGCUUAUCAGACU (SEQ ID NO: 21), or to a nucleotide comprising the sequence UGGAAUGUAAGGAAGUGUGUGG (SEQ ID NO: 9). A method of re-expression of RAS-ERK pathway inhibitory proteins in triple negative cancer cells by administering to a patient having cancer an effective amount of an antagonist of KLF4-dependent microRNAs.