Somatic mutation landscapes at single-molecule resolution

TLDR: NanoSeq as discussed by the authors is a duplex sequencing protocol with error rates of less than five errors per billion base pairs in single DNA molecules from cell populations, enabling the study of somatic mutations in any tissue independently of clonality.

Abstract: Somatic mutations drive the development of cancer and may contribute to ageing and other diseases1,2. Despite their importance, the difficulty of detecting mutations that are only present in single cells or small clones has limited our knowledge of somatic mutagenesis to a minority of tissues. Here, to overcome these limitations, we developed nanorate sequencing (NanoSeq), a duplex sequencing protocol with error rates of less than five errors per billion base pairs in single DNA molecules from cell populations. This rate is two orders of magnitude lower than typical somatic mutation loads, enabling the study of somatic mutations in any tissue independently of clonality. We used this single-molecule sensitivity to study somatic mutations in non-dividing cells across several tissues, comparing stem cells to differentiated cells and studying mutagenesis in the absence of cell division. Differentiated cells in blood and colon displayed remarkably similar mutation loads and signatures to their corresponding stem cells, despite mature blood cells having undergone considerably more divisions. We then characterized the mutational landscape of post-mitotic neurons and polyclonal smooth muscle, confirming that neurons accumulate somatic mutations at a constant rate throughout life without cell division, with similar rates to mitotically active tissues. Together, our results suggest that mutational processes that are independent of cell division are important contributors to somatic mutagenesis. We anticipate that the ability to reliably detect mutations in single DNA molecules could transform our understanding of somatic mutagenesis and enable non-invasive studies on large-scale cohorts. NanoSeq is used to detect mutations in single DNA molecules and analyses show that mutational processes that are independent of cell division are important contributors to somatic mutagenesis.

Full text

Page 1/7
Somatic mutation landscapes at single-molecule
resolution
Stefanie V. Lensing (  sl18@sanger.ac.uk )
Wellcome Sanger Institute
Peter Ellis
Inivata
Federico Abascal
Wellcome Sanger Institute https://orcid.org/0000-0002-6201-1587
Iñigo Martincorena
Wellcome Sanger Institute https://orcid.org/0000-0003-1122-4416
Robert J. Osborne (  r.osborne@biodelity.com )
Biodelity https://orcid.org/0000-0002-1914-1239
Method Article
Keywords: NanoSeq, Mutation, Cancer, Duplex-Sequencing, BotSeqS,
Posted Date: April 28th, 2021
DOI: https://doi.org/10.21203/rs.3.pex-1298/v1
License:   This work is licensed under a Creative Commons Attribution 4.0 International License. 
Read Full License

Page 2/7
Abstract
Somatic mutations drive cancer development and may contribute to ageing and other diseases. Yet, the
diculty of detecting mutations present only in single cells or smallclones has limited our knowledge of
somatic mutagenesis to a minority of tissues. To overcome these limitations, we introduce nanorate
sequencing (NanoSeq), a new duplexsequencing protocol with error rates <5 errors per billion base pairs
in single DNA molecules from cell populations. The version of the protocol described here usesclean
genome fragmentation with a restriction enzyme to preventend-repair-associated errors and
ddBTPs/dATPs during A-tailing to prevent nickextension. Both changes reduce theerror rate of standard
duplex sequencingprotocols by preventing the xation of DNA damage into both strands
ofDNAmolecules during library preparation. We also use qPCR quantication of thelibrary prior to
amplication tooptimise the complexity of the sequencinglibrary given the desired sequencing coverage,
maximising duplex coverage.The sample preparation protocol takes between 1 and 2 days, depending
on the number of samplesprocessed. The bioinformatic protocol isdescribed in:
https://github.com/cancerit/NanoSeq
https://github.com/fa8sanger/NanoSeq_Paper_Code
Introduction
Reagents
NEBNext®Ultra™ II Q5®Master Mix (NEB: M0544L)
HpyCH4V(NEB: R0620L)
T4 DNA Ligase (NEB: M0202L)
dATP Solution (NEB: N0440S)
xGen CS Adapter - Tech Access (IDT: 1080799)
CutSmart®Buffer (NEB: B7204S)
NEBuffer™ 4 (NEB: B7004S)
ATP (Thermo Scientic: R0441)
ddNTP Set, 5 mM solutions (ddCTP, ddGTP, ddTTP) (GE Healthcare: 27204501)

Page 3/7
Klenow Fragment (3'→5' exo-)(M0212L)
Nuclease-free water
Agencourt Ampure XP beads (Beckman Coulter: A63882)
75% Ethanol
KAPA library quantication kit (KK4835)
100 µM NanoqPCR1 primer (HPLC: 5’ACACTCTTTCCCTACACGAC3’)
100 µM NanoqPCR2 primer (HPLC: 5’GTGACTGGAGTTCAGACGTG3’)
UDI containing PCR primers (dried):
i5: AATGATACGGCGACCACCGAGATCTACAC[barcode]ACACTCTTTCCCTACACGACGCTCTTCCGATC*T
i7:CAAGCAGAAGACGGCATACGAGAT[barcode]GTGACTGGAGTTCAGACGTGTGCTCTTCCGATC*T
*phosphorothioate bond
AccuClear Ultra High Sensitivity dsDNA Quantication kit (Biotium: 31028)
Equipment
Full set of pipettes and tips
Plate magnet
Eppendorf twin.tec plates and plate seals
384 well plate and optical seal
Thermocycler
Lightcycler e.g.Roche 480 Lightcycler
Method of DNA quantication e.g. bioanalyzer/plate reader
Sequencer e.g. Nova-seq
Procedure
Library Preparation

Page 4/7
1.Prepare DNA samples and make each sample up to 20 µL in a 96 well twin.tec Eppendorf plate (e.g.
extracted genomic DNA).
2.Perform an Ampure bead clean-up: per sample, mix 50 µL NFW with 50 µL Ampure beads and add
100 µL of this 50:50 mix to each 20 µL sample. Mix well by pipetting up and down and allow DNA to bind
to beads, wash twice with 75% EtOH and re-suspend beads in 20 µL NFW.
3.Prepare a fragmentation mix:
10X CutSmart®Buffer2.5µL
NFW2 µL
HpyCH4V(5U/uL)0.5 µL
4.Add the 5 µL fragmentation mix to the 20 µL bead suspension (this is an on-bead digestion).
5.Incubate at 37ºCfor 15 min on a thermocycler
6.Perform an Ampure bead clean-up: add 62.5 µL Ampure XP beads to each 25 µL sample. Mix well by
pipetting up and down and allow DNA to bind to beads, wash twice with 75% EtOH and elute in 15 µL
NFW.
7.Make up a 1 mMdATP/ddBTP mix (combine 2.5µL100 mM dATP, 50µL5 mM ddCTP, 50µL5 mM
ddTTP, 50µL5 mM ddGTP and 97.5µLNFW.
8.Prepare A-tailing mix:
10X NEBuffer™ 41.5 µL
NFW1.85 µL
1mM dATP/ddBTP mix1.5 µL
Klenow Fragment (3'→5' exo-)0.15 µL
9.Add 5 µL A-tailing mix to 10 µL of the cleaned-up fragmentation product.
10.Incubate at 37 ºC for 30 minon a thermocycler

Page 5/7
11.Prepare ligation mix:
10X NEBuffer™ 42.24 µL
NFW15.53 µL
10 mM ATP3.74 µL
15 µM xGen Duplex Seq Adapters0.33 µL
400 U/µL T4 DNA ligase0.56 µL
12.Add 22.4 µL ligation mix to the 15 µL A-tail product
13.Incubate at20 ºC for 20min on a thermocycler
14.Perform an Ampure bead clean-up: add 37.4 µL Ampure XP beads to each 37.4 µL sample. Mix well
by pipetting up and down and allow DNA to bind to beads, wash twice with 75% EtOH and elute in 50 µL
NFW.
DNA Quantication by qPCR
15.Takea KAPA library quantication kit (KK4835). Add the supplied primer premix to the supplied KAPA
SYBR FAST master mix. In addition add 20µLof 100µM NanoqPCR1 primer (HPLC:
5’ACACTCTTTCCCTACACGAC3’) and 20µLof 100µM NanoqPCR2 primer (HPLC:
5’GTGACTGGAGTTCAGACGTG3’) to the KAPA SYBR FAST master mix.
16.Dilute a fraction of each sample 1 in 500 using NFW and set up triplicate 10 µL qPCR reactions (6µL
master mix, 2µLsample/standard, 2µLwater) in a 384 well plate.
17.Run samples on a qPCR machine e.g.Roche 480 Lightcycler
18.Perform analysis:Absolute quantication (2
nd
Derivative Maximum Method) with the high sensitivity
algorithm).
19.Determine the nM (fmol/ µL) concentration per sample as follows:Mean of sample concentration x
dilution factor (500) x 452/573/1000 (where 452 is the size of the standard in bp and 573 is the proxy for
the average fragment length of the library in bp). We multiply this value by 1.5 to correct for the
performance between different thermocyclers within the laboratory.